Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 6 of 6 results

  1. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...TAL3240 & TAL3241 TGGTGGCGCAGCAGAGGGagctgatccaggaccaGGCCACCGTGAACATCA DLK1 (site #2) TAL3422 & TAL3423...hemogen (site #2) TAL3276 & TAL3277 TGATTTGTTTGTTTGCTaggaggaattcggcggCGACTCAGAGACAGAGA her6 TAL3094 & ... 3012 & TAL 3013 TGGAGCAGGGTGCGAGTGtgtctgagctgaaggaGGCGGTGGGTCGTTTACA park2 (site #2) TAL3334 & TAL3335...pigmentosa 2 (X-linked recessive) TAL3526 & TAL3527 TCTTTTTGTGCTGCGCCAcccagcccataatcgaGTCTTCTACAGGCATGAA retinitis...TAL3178 & TAL3179 TGGAAACCGAGCTGAAGCccccggcgccccagcccaACACCGGGGGCACGGGGA Sox2 (site #2) TAL3368 & TAL3369...TGTTTCAGCAGAGCCCCGctgaagagctccccatGGAGATGGAAGGAGTGGA hif1al (site #2) TAL3280 & TAL3281 TGCCCTCAGGACTTCTGCacgcctgaactccgcaAGCTTCTGTCTCCAATA...abcg2a TAL3400 & TAL3401 TGTCCTCATCCCCGTCCCgccgcggcgccaccgtCAGCTTCCACAACATCAA adam15 TAL3016 & TAL3017...

  2. Synthetic Biology - Assembly Standards Guide

    Type
    Collection
    ...BioBrick-2 BglBrick Silver Standard Freiburg Standard BioBrick (RFC 10) Prefix: GAATTC GCGGCCGC T TCTAGA... (RFC 10) Back to Top BioBrick BB-2 (RFC 12) Prefix: GAATTC GCGGCCGC T ACTAGT G Prefix Enzymes: EcoR1 ...XbaI, SapI For more info, visit iGEM: BioBrick BB-2 (RFC 12) Back to Top BglBrick – Berkeley Standard ...Prefix: GAATTC GCGGCCGC T TCTAGA G Prefix Enzymes: EcoR1 , NotI , XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix... 25) Prefix: GAATTC GCGGCCGC T TCTAGA TG GCCGGC Alternate Prefix: GAATTC GCGGCCGC T TCTAG (for "N-parts...TCTAGA G Alternate Prefix: GAATTC GCGGCCGC T TCTAGA TG (contains start) Prefix Enzymes: EcoR1 , NotI , XbaI...XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: TACTAGAG or TACTAG Features...

  3. Validated gRNA Sequences

    Type
    Collection
    ...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus GTCAAGATGTCATCTTACGG 60971 cut S. pyogenes...rerio GGAGCGAGCGGAGCGGTACA 42244 cut S. pyogenes 23360964 Joung fh D. rerio GGAGCGGTACATGGCGACCG 42243...

  4. Zinc Finger Consortium: Zinc Finger Arrays

    Type
    Collection
    ...corepressor 2 OZ553 and OZ554 OPEN OPEN gCTCACCATCtgttggaTGCGATGGAa cdkn1a (p21) OZ555 and OZ556 OPEN OPEN...modification. Maeder ML et al. Mol Cell. . 2008. Jul 25. 31(2):294-301. PubMed PMID 18657511 . Oligomerized pool...OPEN OPEN gCGTGACCTCgctgatAAGAAGAGg xylt1 OZ509 and OZ510 OPEN OPEN cACCCTCTACaggacaGTAGCGGGTg zgc:153086...OPEN OPEN gCGCCACGGAcaataaaGAGGACTGCa GUSB OZ551 and OZ552 OPEN OPEN gGTCATCTGCcattcGAGGCGGACa REST corepressor...CODA CODA gTCCAGCAGCGGTGAGGATGAAGACg unc119b OZ581 and OZ582 CODA CODA tTGCTGCCGCGGATGCTGTGGCGGTTa cx52.9...cTGCTACTTCtggatGGAGAAACGa pitx2 OZ533 and OZ534 OPEN OPEN cCGCTTCAGCggtctGTGGACTCGa zebrafish similar to grp151 (or gpcr-2037... or cav1.3b OZ547 and OZ548 OPEN OPEN gAGCTCCGTCtcgctgGCGGCCGAAg histamine receptor H3 (hrh3) OZ549 and...

  5. Immunology Research Plasmids and Resources

    Type
    Collection
    ...immunoglobulin heavy diversity 2-15 D2, IGHD215 IGHD2-2 immunoglobulin heavy diversity 2-2 IGHD22 IGHD2-21 immunoglobulin...heat shock 70kDa protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, ...variable 2-33 (non-functional) IGLV233, V1-9 IGLV2-8 immunoglobulin lambda variable 2-8 IGLV28, V1-2 IGLV3...beta 4 DEFB-2, DEFB102, DEFB2, HBD-2, SAP1 EDN1 endothelin 1 ET1, HDLCQ7 EDN2 endothelin 2 ET2, PPET2 ...receptor subfamily 2, group C, member 1 TR2 NR2C2 nuclear receptor subfamily 2, group C, member 2 TAK1, TR2R1...suppression of tumorigenicity 2 - STC1 stanniocalcin 1 STC STC2 stanniocalcin 2 STC-2, STCRP TAC1 tachykinin,...galanin receptor 2 GALNR2, MGC125983, MGC125984 GALR3 galanin receptor 3 - GAST gastrin GAS GCG glucagon GLP1...

  6. CRISPR Guide

    Type
    Collection
    ...Sequences Glossary Publications CRISPR Overview Class 2 C lustered R egularly I nterspaced S hort P alindromic...systems enable researchers to target anywhere from 2 to 7 genetic loci by cloning multiple gRNAs into a... is included on the gRNA-containing plasmid, or a 2-plasmid system in which Cas9 must be delivered separately...library (panel E ). Remember - if you are using a 2-vector system, you will need to transduce cells that...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...either (1) a lack of gRNA and/or Cas9 expression or (2) a lack of efficient target cleavage in cells expressing...off-target effects by using a single Cas9 nickase and 2 different gRNAs, which bind in close proximity on ...
Showing: 1 - 6 of 6 results