Skip to main content

We narrowed to 5 results for: gcg.2

Showing: 1 - 5 of 5 results
  1. Synthetic Biology - Assembly Standards Guide

    Type
    Collection
    ...BioBrick-2 BglBrick Silver Standard Freiburg Standard BioBrick (RFC 10) Prefix: GAATTC GCGGCCGC T TCTAGA... (RFC 10) Back to Top BioBrick BB-2 (RFC 12) Prefix: GAATTC GCGGCCGC T ACTAGT G Prefix Enzymes: EcoR1 ...XbaI, SapI For more info, visit iGEM: BioBrick BB-2 (RFC 12) Back to Top BglBrick – Berkeley Standard ...Prefix: GAATTC GCGGCCGC T TCTAGA G Prefix Enzymes: EcoR1 , NotI , XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix... 25) Prefix: GAATTC GCGGCCGC T TCTAGA TG GCCGGC Alternate Prefix: GAATTC GCGGCCGC T TCTAG (for "N-parts...TCTAGA G Alternate Prefix: GAATTC GCGGCCGC T TCTAGA TG (contains start) Prefix Enzymes: EcoR1 , NotI , XbaI...XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: TACTAGAG or TACTAG Features...
  2. Validated gRNA Sequences

    Type
    Collection
    ...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus GTCAAGATGTCATCTTACGG 60971 cut S. pyogenes...rerio GGAGCGAGCGGAGCGGTACA 42244 cut S. pyogenes 23360964 Joung fh D. rerio GGAGCGGTACATGGCGACCG 42243...
  3. Zinc Finger Consortium: Zinc Finger Arrays

    Type
    Collection
    ...corepressor 2 OZ553 and OZ554 OPEN OPEN gCTCACCATCtgttggaTGCGATGGAa cdkn1a (p21) OZ555 and OZ556 OPEN OPEN...modification. Maeder ML et al. Mol Cell. . 2008. Jul 25. 31(2):294-301. PubMed PMID 18657511 . Oligomerized pool...OPEN OPEN gCGTGACCTCgctgatAAGAAGAGg xylt1 OZ509 and OZ510 OPEN OPEN cACCCTCTACaggacaGTAGCGGGTg zgc:153086...OPEN OPEN gCGCCACGGAcaataaaGAGGACTGCa GUSB OZ551 and OZ552 OPEN OPEN gGTCATCTGCcattcGAGGCGGACa REST corepressor...CODA CODA gTCCAGCAGCGGTGAGGATGAAGACg unc119b OZ581 and OZ582 CODA CODA tTGCTGCCGCGGATGCTGTGGCGGTTa cx52.9...cTGCTACTTCtggatGGAGAAACGa pitx2 OZ533 and OZ534 OPEN OPEN cCGCTTCAGCggtctGTGGACTCGa zebrafish similar to grp151 (or gpcr-2037... or cav1.3b OZ547 and OZ548 OPEN OPEN gAGCTCCGTCtcgctgGCGGCCGAAg histamine receptor H3 (hrh3) OZ549 and...
  4. Immunology Research Plasmids and Resources

    Type
    Collection
    ...immunoglobulin heavy diversity 2-15 D2, IGHD215 IGHD2-2 immunoglobulin heavy diversity 2-2 IGHD22 IGHD2-21 immunoglobulin...heat shock 70kDa protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, ...variable 2-33 (non-functional) IGLV233, V1-9 IGLV2-8 immunoglobulin lambda variable 2-8 IGLV28, V1-2 IGLV3...beta 4 DEFB-2, DEFB102, DEFB2, HBD-2, SAP1 EDN1 endothelin 1 ET1, HDLCQ7 EDN2 endothelin 2 ET2, PPET2 ...receptor subfamily 2, group C, member 1 TR2 NR2C2 nuclear receptor subfamily 2, group C, member 2 TAK1, TR2R1...suppression of tumorigenicity 2 - STC1 stanniocalcin 1 STC STC2 stanniocalcin 2 STC-2, STCRP TAC1 tachykinin,...galanin receptor 2 GALNR2, MGC125983, MGC125984 GALR3 galanin receptor 3 - GAST gastrin GAS GCG glucagon GLP1...
  5. CRISPR Guide

    Type
    Collection
    ...Browse Plasmids: Double-Strand Break (Cut) Figure 2: Overview of the NHEJ repair mechanism. Multiplex ...systems enable researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single...Cas9 is included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...your experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with...the presence of infectious organisms (like SARS-CoV-2 ) and genetic mutations. Similar to Cas9 and Cas12...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...off-target effects by using a single Cas9 nickase and 2 different gRNAs, which bind in close proximity on ...
Showing: 1 - 5 of 5 results