We narrowed to 7,209 results for: GAN
-
Plasmid#109813PurposeProtein expression and purification of SIAH2_SinaDepositorInsertSIAH2_Sina (SIAH2 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pF3BGX-T2A-GAL4
Plasmid#138392PurposeRMCE vector for generating C-terminal T2A-GAL4 fusionDepositorInsertT2A-GAL4
ExpressionInsectAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
SuperNova-TGON3
Plasmid#131859PurposeExpresses NuperNova fused to trans-Golgi protein TGON3DepositorInsertSuperNova
TagsTGON3 (rat)ExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK260
Plasmid#129252Purposedual yTRAP, NM fusion to aTF1 reporting on [PSI+] state with mKate2 reporterDepositorInsertSup35 NM yTRAP sensor reporting on mKate2
ExpressionYeastAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWT055f
Plasmid#96865PurposesgRNA-FANCFDepositorInsertsgRNA-FANCF
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT055g
Plasmid#96864PurposesgRNA-HEK3DepositorInsertsgRNA-HEK3
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBALU9
Plasmid#69324PurposeEncodes a recombineering cassette for tagging a target gene within a genomic clone with a fluorescent protein. Cassette: bicistronic; FRT-galK-FRT in 2nd GFP intron;use C-term after STOPDepositorInsertgSL2-NLS-GFPint-FgF
ExpressionBacterialAvailable SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDpy-7::oxCerulean-oxVenus::Lgg-1
Plasmid#68042PurposeLgg-1 tagged with oxCerulean-oxVenus (dFP, or double fluorescent protein), expressed in hypodermis, for monitoring autophagyDepositorInsertpDpy-7::oxCerulean-oxVenus::Lgg-1
ExpressionWormAvailable SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPD95_03
Plasmid#1479DepositorTypeEmpty backboneTagsIVSA, SV40NLS, lacZN, IVSB, IVSD, IVSE, IVSF, IVS…ExpressionWormAvailable SinceMarch 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
L4759
Plasmid#1677DepositorTypeEmpty backboneTagslet858enh>>, let858enh<<, let858-455,…ExpressionWormAvailable SinceMarch 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
L4781
Plasmid#1679DepositorTypeEmpty backboneTagsIVSA, rf2204, ATG-MitLS, gfpN, IVSR, gfpGLA, IVSS…ExpressionWormAvailable SinceMarch 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rig-3P::AI::lgc-47::SL2::GFP::unc-54-3'UTR
Plasmid#225924PurposeExpressing LGC-47 in AVA neuronDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJK2067
Plasmid#171845PurposeC. elegans mex-5 promoter (germline) driven dual fluorescent reporter for boxB tethering (eGFP) with boxB negative control (mCherry)DepositorInserthis-58, eGFP, mCherry
TagsN-terminal Tag OLLAS, V5 and C-terminal Tag PEST…ExpressionWormMutationboxB wild type and hairpin mutantPromotermex-5 promoterAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21a Ce-iPGM-bio
Plasmid#162559PurposeExpresses C. elegans iPGM containing a C-terminal biotinylation site and His tagDepositorInsertC. elegans iPGM bio-6His (ipgm-1 Nematode)
Tags6His tag, T7 tag, Thrombin cleavage site, and bio…ExpressionBacterialPromoterT7Available SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSEM271 - MCS mosTI NeoR target
Plasmid#159830PurposeSingle copy or array insertion by MosTI using split NeoR selectionDepositorInsertMCS mosTI NeoR target
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
AP1297‐1
Plasmid#87247Purposegtbp‐1 (flanking sequence)::eGFP::gtbp‐1 (27bp)::PH::gtbp‐ 1 (flanking sequence)DepositorInsertgtbp‐1 (flanking sequence)::eGFP::gtbp‐1 (27bp)::PH::gtbp‐ 1 (flanking sequence)
Tagsgtbp‐1 (flanking sequence)::eGFP::gtbp‐1 (27bp)::…Available SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGC91
Plasmid#19621DepositorInsertPrpl-28<4xNLS-GFP::let-858(3’)-(Cbr)unc-119(+)<1xNLS-lacZ::unc-54(3’)
UseFlp/frtExpressionWormAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGC200
Plasmid#19623DepositorInsertPpro-1<4xNLS-GFP::let-858(3’)-(Cbr)unc-119(+)<1xNLS-lacZ::unc-54(3’)
UseFlp/frtExpressionWormAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV Aquamarine-shadowG tandem
Plasmid#157774PurposeProduces a fusion between Aquamarine and shadowG. It can be used as a positive control for FRET (using FLIM)DepositorTypeEmpty backboneTagsAquamarine and shadowGExpressionMammalianAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only