We narrowed to 7,413 results for: ESP
-
Plasmid#70474PurposeGateway ORF clone of human PREX2 [NM_024870.2] without stop codon (for C-terminal fusions)DepositorInsertPREX2 (PREX2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E076 Hs.EXOC5-nostop
Plasmid#70360PurposeGateway ORF clone of human EXOC5 [NM_006544.3] without stop codon (for C-terminal fusions)DepositorInsertEXOC5 (EXOC5 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E079 Hs.EXOC7
Plasmid#70363PurposeGateway ORF clone of human EXOC7 [NM_001013839.3] with stop codon (for native or N-terminal fusions)DepositorInsertEXOC7 (EXOC7 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiCh2-2
Plasmid#202444PurposeExpression of a CRISPRi control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertChromosome 2 gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
p416-GPD-DDP1
Plasmid#183950PurposeExpresses yeast DDP1 from yeast GPD promoterDepositorAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUPD2+pNRP
Plasmid#170881PurposePhytobrick - pNRPDepositorInsertpNRP
ExpressionPlantAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
His-SUMO-hDDI2-D252N_pET11a
Plasmid#169122Purposeexpression of proteinDepositorAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBL119-2
Plasmid#104336PurposeExpresses thsR from a TetR regulated promoter under ATC control. Expresses sfGFP from a thsR regulated promoter. Expresses mCherry from a constituative promoter.DepositorInsertThiosulfate response regulator
ExpressionBacterialPromoterPLTetO1Available SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
MIP-T3
Plasmid#99511Purposeto express MIP-T3 in mammalian systemDepositorAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
R777-E132 Hs.MET-nostop
Plasmid#70416PurposeGateway ORF clone of human MET [NM_000245.2] without stop codon (for C-terminal fusions)DepositorInsertMET (MET Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E122 Hs.MAP2K1-nostop
Plasmid#70406PurposeGateway ORF clone of human MAP2K1 [NM_002755.3] without stop codon (for C-terminal fusions)DepositorInsertMAP2K1 (MAP2K1 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E004 Hs.AKT2-nostop
Plasmid#70288PurposeGateway ORF clone of human AKT2 [NM_001626.5] without stop codon (for C-terminal fusions)DepositorInsertAKT 2 (AKT2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-SS-247
Plasmid#68761PurposeZF9-TF-V2 with mCherry markerDepositorInsertsZF9-TF-V2
mCherry
TagsNLS and flagExpressionMammalianAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hpGRISZ-TM
Plasmid#248028PurposePlasmid for packing AAV for hpGRISZ (synaptic zinc sensor)DepositorInserthpGRISZ
UseAAVPromoterhSynAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-UDP1.0-IRES-mCherry-CAAX
Plasmid#220850PurposeCMV promoter drives the expression of an extracellular UDP sensor (UDP1.0) and a membrane localized mCherryDepositorInsertUDP1.0
ExpressionMammalianPromoterCMVAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
131-2a_LC
Plasmid#215331PurposeExpression monoclonal antibody 131-2a LCDepositorInsert131-2a_LC
ExpressionMammalianPromoterCMVAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F2
Plasmid#184164PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 2, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F0
Plasmid#184162PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 0, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
PclpB GFP pZa
Plasmid#170074PurposeGFP expression under the control of E. coli clpB promoterDepositorInsertGreen fluorescent protein
ExpressionBacterialPromoterPclpBAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only