We narrowed to 5,008 results for: AAT
-
Plasmid#31120DepositorAvailable SinceJuly 28, 2011AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.1-puro-cfRabin8_4
Plasmid#26713DepositorInsertdog Rabin8 RNAi
UseLentiviral and RNAiExpressionMammalianMutationRNAi to dog Rabin8 alpha isoform.Available SinceDec. 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_NTC4
Plasmid#183336PurposeAll-in-One CRISPRko system containing a non-targeting controlDepositorInsertNTC4
UseLentiviralAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR V2 Hygro sgIKBKG_2
Plasmid#241450PurposeDelete IKBKGDepositorAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgSeLEU2
Plasmid#224870PurposeDisruption of S. eubayanus type LEU2 genesDepositorInsertpYAMTr2GC having the guide sequence SeLEU2 (DI49_0736 Budding Yeast)
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA_SRR134.3_miRFP670
Plasmid#163754PurposegRNA expression vector containing the miRFP670 fluorescent marker to target the region downstream of the SRR134 SOX2 enhancer in human cells.DepositorInsertgRNA_SRR134.3
UseCRISPRTagsmiRFP670ExpressionMammalianPromoterU6Available SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g2 LentiCRISPRv2-mCherry
Plasmid#218663PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Bilbo -eCMV-CjSpD8A-3XFLAG-SV40 NLS-ITR2
Plasmid#210749PurposeCoding for CjSp D8A alongside Bilbo sgRNA targeting CAG repeatsDepositorInsertsCjSp D8A Cas9
Bilbo sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD8A, N-terminal Cj Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB2
Plasmid#197355PurposeA knock-out vector for dog ErbB2.DepositorInsertA gRNA targeting the dog ERBB2 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX458-dErbB3
Plasmid#197356PurposeA knock-out vector for dog ErbB3.DepositorInsertA gRNA targeting the dog ERBB3 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1067L
Plasmid#200253PurposepBac-U6-gRNA(doublesex+Intersex+bTublin)-3xp3-tdTomatoDepositorInsert6 gRNAs targeting Doublesex, Intersex, bTublin
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
tet pLKO.1-shNUP37 v2 puro
Plasmid#192344PurposeLentiviral expression vector for an inducible shNUP37 v2DepositorInsertshNUP37 v2 (NUP37 Human)
UseLentiviralAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE010-Target1 (Mpphot)
Plasmid#186728PurposeBinary vector for CRISPR/Cas9 (target 1: Mpphot [positive control]) in plants (for Agrobacterium-mediated genetic transformation).DepositorInsertMphot
ExpressionBacterialAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgPIGA guide 1
Plasmid#193610PurposePIGA knockoutDepositorInsertsgPIGA guide 1 (PIGA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgPIGW guide 1
Plasmid#193612PurposePIGW knockoutDepositorInsertsgPIGW guide 1 (PIGW Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgPIGW guide 2
Plasmid#193613PurposePIGW knockoutDepositorInsertsgPIGW guide 2 (PIGW Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgSNRPA guide 2
Plasmid#193599PurposeSNRPA knockoutDepositorInsertsgSNRPA guide 2 (SNRPA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Blimp1-L1-#1
Plasmid#171503Purposedeletion of a genomic locus in Blimp1(Prdm1) geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)_g1_CASH-1
Plasmid#188975PurposeA human codon-optimized SpCas9 nickase and chimeric g1 guide RNA expression plasmid.DepositorInsertg1 guide RNA
ExpressionMammalianAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only