We narrowed to 18,932 results for: CAG
-
Plasmid#51264PurposeComponent of the Bxb1-rcCre binary site-specific recombinase system, reverse complementary Cre CDS flanked by Bxb1 attB/P recognition sites in head-to-head orientationDepositorInsertattBr-Cre-rc-attP
ExpressionMammalianPromoterCAGAvailable SinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-attBr-Cre-rc-attP
Plasmid#51264PurposeComponent of the Bxb1-rcCre binary site-specific recombinase system, reverse complementary Cre CDS flanked by Bxb1 attB/P recognition sites in head-to-head orientationDepositorInsertattBr-Cre-rc-attP
ExpressionMammalianPromoterCAGAvailable SinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex-GFP
Plasmid#197883PurposeCan be used to generate AAV virus that will express GFP in the presence of CreDepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex-GFP
Plasmid#197883PurposeCan be used to generate AAV virus that will express GFP in the presence of CreDepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAG::PSAMQ79G:GlyR-IRES-GFP
Plasmid#32482PurposeExpresses PSAM-GlyR (Q79G) neuronal inhibitor, with IRES-EGFP markerDepositorInsertPSAMQ79G-GlyR
TagsIRES-EGFPExpressionMammalianPromoterCAGAvailable SinceApril 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
CAG::PSAMQ79G:GlyR-IRES-GFP
Plasmid#32482PurposeExpresses PSAM-GlyR (Q79G) neuronal inhibitor, with IRES-EGFP markerDepositorInsertPSAMQ79G-GlyR
TagsIRES-EGFPExpressionMammalianPromoterCAGAvailable SinceApril 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FLAG-BMAL1-S513A
Plasmid#186831PurposeExpresses FLAG-BMAL1-S513A in mammalian cellsDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FLAG-BMAL1-S515A
Plasmid#186832PurposeExpresses FLAG-BMAL1-S515A in mammalian cellsDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FLAG-BMAL1-S516A
Plasmid#186833PurposeExpresses FLAG-BMAL1-S516A in mammalian cellsDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FLAG-BMAL1-S519A
Plasmid#186834PurposeExpresses FLAG-BMAL1-S519A in mammalian cellsDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FLAG-BMAL1-S513A
Plasmid#186831PurposeExpresses FLAG-BMAL1-S513A in mammalian cellsDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FLAG-BMAL1-S515A
Plasmid#186832PurposeExpresses FLAG-BMAL1-S515A in mammalian cellsDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FLAG-BMAL1-S516A
Plasmid#186833PurposeExpresses FLAG-BMAL1-S516A in mammalian cellsDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FLAG-BMAL1-S519A
Plasmid#186834PurposeExpresses FLAG-BMAL1-S519A in mammalian cellsDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Flag-S1pr1-R120A
Plasmid#203707PurposeOverexpression of FLAG-S1PR1-R120A mutant.DepositorAvailable SinceDec. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Flag-S1pr1-R120A
Plasmid#203707PurposeOverexpression of FLAG-S1PR1-R120A mutant.DepositorAvailable SinceDec. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only