We narrowed to 4,208 results for: ttl
-
Plasmid#118239PurposeKanamycin-resistant E.coli/B. burgdorferi shuttle vector; Encodes bb0026 promoter driven mCherryDepositorInsertbb0026 promoter driven mCherry
ExpressionBacterialAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJB06
Plasmid#190480PurposeBase Cas9 expression plasmid for 2-plasmid C. difficile mutagenesis systemDepositorInsertsCas9
XylR
UseE. coli / b. subtilis - c. difficile shuttle vect…PromoterxylR-driven promoterAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJB07
Plasmid#190481PurposeTargeting plasmid for 2-plasmid C. difficile mutagenesis systemDepositorInsertsUpstream & Downstream pyrE deletion region
gRNA
UseE. coli / b. subtilis - c. difficile shuttle vect…Available SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYHY3
Plasmid#216109PurposeaTC-inducible expression of secretory BT3630 SP-NanoLuc via P1TDP-A21 promoter-RBS pair in Bacteroides species.DepositorInsertNanoLuc
UseSynthetic Biology; E. coli-bacteroides shuttle ve…Tags3xFLAG tag and BT3630 signal peptideExpressionBacterialPromoterP1TDP-A21Available SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLBac-Bat-FluA-trimer
Plasmid#229858PurposeInfluenza A/little yellow-shouldered bat/Guatemala/060/2010(H17N10) polymerase heterotrimer (self-cleaving polyprotein)DepositorInsertsPA_Bat-FluA_AFC35437.1
PB1_Bat-FluA_AFC35436
PB2_Bat-FluA_AFC35435.1
ExpressionInsectAvailable SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBSV2_PresT-mCherryBb
Plasmid#118238PurposeKanamycin-resistant E.coli/B. burgdorferi shuttle vector; Encodes resT promoter driven mCherryDepositorInsertresT promoter driven mCherry
ExpressionBacterialAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBSV2_P0031-mCherryBb
Plasmid#118240PurposeKanamycin-resistant E.coli/B. burgdorferi shuttle vector; Encodes bb0031 promoter driven mCherryDepositorInsertbb0031 promoter driven mCherry
ExpressionBacterialAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pST-K
Plasmid#44560Purposefor ectopic constitutive expression of mycobacterial proteinsDepositorTypeEmpty backboneUseE.coli-mycobacteria shuttle vectorTagsFlag tag and His tagExpressionBacterialPromoterUV15 promoterAvailable SinceOct. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
p201B Cas9
Plasmid#59177PurposeCas9 driven by double 35S, BAR for plant selection, I-PpoI site to accept gRNA from pUC gRNA ShuttleDepositorInsertsCas9
BAR
UseCRISPRPromoter2x35SAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pST-KiT
Plasmid#44562Purposefor integrative inducible expression of mycobacterial proteinsDepositorTypeEmpty backboneUseE.coli-mycobacteria shuttle vectorTagsFlag tag and His tagExpressionBacterialAvailable SinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBSV2G_PflaB-iRFPBb
Plasmid#118237PurposeGentamicin-resistant E.coli/B. burgdorferi shuttle vector; Encodes flagellin promoter driven iRFPDepositorInsertflagellin promoter driven iRFP
ExpressionBacterialAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFTK094-LM-AMA002.0
Plasmid#171366PurposeEntry Vector compatible, fungal replicating, shuttle backbone vector from the Fungal Modular Cloning ToolKit.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLGB28
Plasmid#126617PurposepNBU2-derived shuttle vector for integration at attBT2 sites in Bacteroides chromosomes, inulin selection for use in anbitiotic resistant strainsDepositorTypeEmpty backboneUseUnspecified; Chromosomal integration suicide vect…Available SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBSV2G_PflaB-mCherryBb
Plasmid#118230PurposeGentamicin-resistant E.coli/B. burgdorferi shuttle vector; Encodes flagellin promoter driven mCherryDepositorInsertflagellin promoter driven mCherry
ExpressionBacterialAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKM197
Plasmid#132665PurposepyrE-targeted CRISPR-Cas9 control plasmid. Cas9 expression is controlled by the xylR promoter and results in improved conjugation efficiency. Induction with xylose results in a pyrE mutant.DepositorInsertUpstream & Downstream pyrE deletion region
UseE. coli - c. difficile shuttle vectorAvailable SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pESC-URA-GFP-Ubc9ts
Plasmid#20369DepositorInsertSUMO-conjugating enzyme Ubc9 (UBC9 Budding Yeast)
UseYeast/bacteria shuttleTagsGFPExpressionYeastMutationY68L This mutation renders Ubc9 temperature-sens…Available SinceMay 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pESC-LEU-GFP-VHL
Plasmid#21053DepositorInsertvon Hippel-Lindau tumor suppressor (VHL Human)
UseYeast/bacteria shuttleTagsGFPExpressionYeastAvailable SinceMay 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMGA-ptac-sfGFP
Plasmid#139934PurposeIPTG-inducible sfGFP expression on M. magneticum/E. coli shuttle vectorDepositorInsertLacI-Ptac-sfGFP
ExpressionBacterialAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCL66-decoder
Plasmid#159453PurposeInsert: Pfus1mut-tetR-nls-malE-tCyc1. Same insert as pCL33-decoder in a multiple integration shuttle vector. Backbone: pRG235 (addgene). Marker: Leu2.DepositorInsertPfus1mut-tetR-nls-malE-tCyc1
UseSynthetic BiologyExpressionYeastPromoterPfus1mutAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only