We narrowed to 11,287 results for: AGA
-
Plasmid#82528PurposeExpresses mutant GST-CD-ATLm (Cbx7) fusion proteins in E. coli. Cbx7 amino acids 1-84 with mutation of RKR70-72, K75, and KR77-78 to AGA70-72, A75, and AG77-78.DepositorInsertChromobox Homolog 7 (CBX7 Human)
TagsGSTExpressionBacterialMutationamino acids 1-84 with mutation of RKR70-72, K75, …Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast-cfRab25_2
Plasmid#26711DepositorInsertdog Rab25 RNAi
UseLentiviral and RNAiExpressionMammalianMutationRNAi to canine Rab25.Available SinceDec. 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR V2-mCherry sgmRELA_1
Plasmid#241447PurposeDelete mouse RelaDepositorAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
CBE-Cas12a-GFP
Plasmid#246533PurposePlant co-editing vectorDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterCmYLCVAvailable SinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLPo-3xmiR122-WPRE-HGHpA
Plasmid#220938PurposeFLPo recombinaseDepositorInsertCodon-optimized FLPe recombinase
UseAAVAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-tetR
Plasmid#238043PurposeModified ADEPT-pCas9 with sfGFP under TtrB promoter for tetrathionate (TTR) sensing.DepositorInsertsfGFP
UseSynthetic BiologyPromoterttrBAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.6
Plasmid#235471PurposeMessage phagemid carrying sgRNA6 (prom. J23110, backbone pBR322)DepositorInsertsgRNA6
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.1
Plasmid#235460PurposeMessage phagemid carrying sgRNA1 (prom. J23119, backbone pBR322)DepositorInsertsgRNA1
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.4
Plasmid#235463PurposeMessage phagemid carrying sgRNA4 (prom. J23119, backbone pBR322)DepositorInsertsgRNA4
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.5
Plasmid#235464PurposeMessage phagemid carrying sgRNA5 (prom. J23119, backbone pBR322)DepositorInsertsgRNA5
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.6
Plasmid#235465PurposeMessage phagemid carrying sgRNA6 (prom. J23119, backbone pBR322)DepositorInsertsgRNA6
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.1
Plasmid#235466PurposeMessage phagemid carrying sgRNA1 (prom. J23110, backbone pBR322)DepositorInsertsgRNA1
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.4
Plasmid#235469PurposeMessage phagemid carrying sgRNA4 (prom. J23110, backbone pBR322)DepositorInsertsgRNA4
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.5
Plasmid#235470PurposeMessage phagemid carrying sgRNA5 (prom. J23110, backbone pBR322)DepositorInsertsgRNA5
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
NarP-GFP
Plasmid#220161PurposeTo track the natural NarP promoter's transcriptional dynamicsDepositorInsertNarP promoter only
ExpressionBacterialAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS3-5xQUAS::Δpes-10P::AI::gur-3G
Plasmid#232613PurposeExpression of 'GUR-3' on activation via 'QF+hGR' chimeric proteinDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::QF+hGR::SL2::tagBFP
Plasmid#232607PurposePan-neuronal expression of chimeric protein 'QF+hGR' and fluorophore 'tagBFP', regulated by rab-3 promoter and unc-54 3' UTRDepositorInsertQF+hGR
ExpressionWormMutationN/AAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::gur-3G
Plasmid#232605PurposePan-neuronal expression of 'GUR-3' using a genomic fragment, regulated by rab-3 promoter and unc-54 3' UTRDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only