We narrowed to 11,287 results for: AGA
-
Viral Prep#199775-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from AiP13778 - pAAV-AiE0450h-minBG-iCre(R297T)-BGHpA (Alias: CN3778) (#199775). In addition to the viral particles, you will also receive purified AiP13778 - pAAV-AiE0450h-minBG-iCre(R297T)-BGHpA (Alias: CN3778) plasmid DNA. Cre recombinase expression in striatal medium spiny neurons. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only
-
AiP11839-pAAV-hSyn1-SYFP2-10aa-H2B-WPRE3-BGHpA (Alias: CN1839) (AAV PHP.eB)
Viral Prep#163509-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from AiP11839-pAAV-hSyn1-SYFP2-10aa-H2B-WPRE3-BGHpA (Alias: CN1839) (#163509). In addition to the viral particles, you will also receive purified AiP11839-pAAV-hSyn1-SYFP2-10aa-H2B-WPRE3-BGHpA (Alias: CN1839) plasmid DNA. hSyn1-driven expression for nuclear SYFP2 labeling in neurons. Useful for nuclear isolation and scRNA-seq applications. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsSYFP2Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ekker Lab TALEN kit
Plasmid Kit#1000000038PurposeContains all 256 possible combinations of pFUS_B4 clones for Golden Gate assembly of 15-RVD TALENs for high-throughput mutagenesisDepositorAvailable SinceMarch 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
AiP11390-pAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1390) (AAV PHP.eB)
Viral Prep#163505-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from AiP11390-pAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1390) (#163505). In addition to the viral particles, you will also receive purified AiP11390-pAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1390) plasmid DNA. AAV vector for strong and rapid SYFP2 expression in forebrain GABAergic interneurons. The enhancer core sequence has 100% sequence conservation between mouse and human. Developed especially for rapid viral labeling in human and NHP organotypic brain slice culture. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterminBetaGlobinTagsSYFP2Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pmyo-3::hpo-30 gDNA (pBAB204)
Plasmid#117385PurposeAllows for body-wall muscle expression of HPO-30DepositorInsertgenomic DNA of hpo-30 (833 bp)
ExpressionWormAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFlare9A-Clip2E9 Mutant
Plasmid#209575Purposeminigene construct for Clip2 E9 alternative splicing, potential PTBP2 binding sites are deletedDepositorInsertClip2 (Clip2 Mouse)
ExpressionMammalianMutationACGCGTTTCTGAATTCTTCTAACTGCCCTCAAATGCACGGTGGCATGTG…PromoterCMVAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-SF3B1-NTerm
Plasmid#97425PurposeExpresses human SF3B1 (AA 1-500) with N-term GST tag for inducible expression in E.coliDepositorInsertSF3B1-N-term (AA1-500)
TagsGSTExpressionBacterialMutationSilent mutation at nt876, aa289 (AGG to AGA)PromotertacAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
FHp5pUP95C3,5SGW (E5)
Plasmid#74035Purposelentiviral expression of Psd95 shRNA and Psd95-C3,5S-EGFP fusionDepositorInsertPsd95
UseLentiviral and RNAiExpressionMammalianMutationPCR: C3,5S (tct aga cca cca tgg act Ctc tAt CGa t…PromoterH1Available SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Satb2 sesRNA-2a-msFlag-2a-tTA-WPRE
Plasmid#239028PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUCsRNAP
Plasmid#182746PurposeSwapping in small RNA promoter, 23-bp spacer sequence, & 19-bp repeats into pJC005 plasmidsDepositorInsertsmall RNA promoter, a 23-bp spacer sequence, & 19-bp repeats
UseCRISPRAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRA03
Plasmid#103141PurposeTriple gRNA expression separated with 28nt Csy4 motifDepositorInsertgRNAs
ExpressionYeastAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7535 pHR (hU6-crSURF2-EFS-PuroR-WPRE)
Plasmid#214879PurposeLentiviral vector encoding RfxCas13d targeting SURF2 guide arrayDepositorInserthU6-crSURF2-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTC362
Plasmid#91216Purposeprotoplast vector for targeted deletion of 6 genes in tomatoDepositorInsertgRNAs targeting 6 tomato genes
UseCRISPRExpressionPlantAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-42_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211682PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-42 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_6
Plasmid#155064PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pED7x26
Plasmid#134813PurposeStringent phage propagation reporter containing pIII-16-29-34-TAGADepositorInsertpIII 16-TAGA 29-TAGA 34-TAGA
UseSynthetic BiologyExpressionBacterialMutation16-TAGA 29-TAGA 34-TAGAAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK01_Rho_minprox_DsREd
Plasmid#173489PurposePCR template for reporter gene with mouse Rhodopsin promoter with DsRedDepositorInsertMouse Rhodopsin promoter driving DsRed reporter gene
ExpressionMammalianPromoterMouse RhodopsinAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PDGFRb-IRES2-EGFP
Plasmid#204354PurposeExpresses wild-type PDGFRb gene.DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
Available SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1050K (firefly luciferase)
Plasmid#132422Purposeexpress arrays of gRNA targeting Firefly Luciferase under dU6-3 promoterDepositorInsertfirefly Luciferase gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only