We narrowed to 11,272 results for: cat.1
-
Plasmid#183689PurposeRetroviral expression of ER-targeted metastable Halotag/folding sensor (HaloK73T)DepositorInsertER Halo(K73T)
UseRetroviralMutationK73T in HalotagAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH_ss-SBP-EGFP
Plasmid#172358PurposeReporter to monitoring a streptavidin-binding peptide traffickingDepositorInsertER importing signal sequence
UseLentiviralTagsSBP-EGFPExpressionMammalianPromoterCMVAvailable SinceJune 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKC123
Plasmid#134240Purposeexpresses gRNA targeting CENP A 3'DepositorInsertCENP A 3' CRISPR construct
UseCRISPRExpressionMammalianAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIDTsmart-RC2-KO-454TAG
Plasmid#240063PurposeExpress AAV2-KO (R585,588A) capsid with ncAA mutant at site 454DepositorInsertAAV2-454-TAG, R585,588A
UseAAVExpressionMammalianAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIDTsmart-RC2-454TAG
Plasmid#240058PurposeExpress AAV2 capsid with ncAA mutant at site 454DepositorInsertAAV2 Rep Cap-454-TAG
UseAAVExpressionMammalianAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDF_AaRaf1/BSD2
Plasmid#229516PurposeExpresses Anthoceros agrestis chaperones: Raf1,BSD2DepositorInsertsRubisco accumulation factor 1
BSD2
ExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV[FLEX]-CAG-EGFP-pri-miR-Ctrl
Plasmid#235158PurposeExpresses EGFP and a control primary transcript in a Cre recombinase-dependent mannerDepositorInsertEGFP/primary transcript with control siRNA
UseAAVPromoterCAGAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV[FLEX]-CAG-EGFP-miR-206-sponge
Plasmid#235154PurposeExpresses a EGFP-based sponge for miR-206 in a Cre recombinase-dependent mannerDepositorInsertEGFP/miR-206 sponge with 12x binding sites
UseAAVPromoterCAGAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV[FLEX]-CAG-EGFP-miR-133-sponge
Plasmid#235155PurposeExpresses a EGFP-based sponge for miR-133 in a Cre recombinase-dependent mannerDepositorInsertEGFP/miR-133 sponge with 12x binding sites
UseAAVPromoterCAGAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
SP_H6_Halo_L172Q_KDEL_pBABEpu
Plasmid#183690PurposeRetroviral expression of ER-targeted metastable Halotag/folding sensor (ER HaloL172Q)DepositorInsertER Halo(L172Q)
UseRetroviralMutationL72Q in HalotagAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
SP_H6_Halo_M21K_F86L_KDEL_pBABEpu
Plasmid#183691PurposeRetroviral expression of ER-targeted metastable Halotag/folding sensor (ER HaloM21K_F86L)DepositorInsertER Halo(M21K_F86L)
UseRetroviralMutationM21K_F86L in HalotagAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET30_Halotag_K73T_Jdomain
Plasmid#183693PurposeBacterial expression of ER-targeted metastable Halotag/folding sensor (HaloK73T) fused with J domainDepositorInsertER Halo(K73T)-J domain
ExpressionBacterialMutationK73T in HalotagAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0058
Plasmid#177022PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertgeraniol 8-oxidase; geraniol-10-hydroxylase; CYP76B6
UseSynthetic BiologyAvailable SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0062
Plasmid#177027PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsert7-deoxyloganetic acid glucosyl transferase; UGT709C2
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0059
Plasmid#177023PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsert8-hydroxygeraniol oxidoreductase; 10-hydroxygeraniol oxidoreductase; alcohol dehydrogenase 10
UseSynthetic BiologyAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-NES-ZapCV2
Plasmid#222950PurposeGenetically-encoded Cytosolic Cyan-Yellow Zinc FRET sensor. Useful for detecting free zinc ion levels in the cytosol (in vitro Kd ~2.3 nM, n = 0.53)DepositorInsertNES-ZapCV2
TagsECFP (Enhanced Cyan Fluorescent Protein), Nuclear…ExpressionMammalianMutationECFP gene is truncated 36 bp at 3' end. Venu…Available SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSMPUW-miR-124-GFP-Puro
Plasmid#117321PurposeOverexpression of miR-124 in eurkaryotic cells, encoded in a human beta-globin intronDepositorInserthsa-miR-124-1 (MIR124-1 Human)
UseLentiviralTagsGFP-PuroExpressionMammalianPromoterEF1aAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pb-NES-ZapCV5 (cpV143)
Plasmid#112061PurposeGenetically-encoded Cyan-Yellow Zinc FRET sensor. Localizes to the cytosol. Low affinity to free zinc (Kd ~ 300nM, n = 0.55) due to mutation of the zinc binding Cys residues to His.DepositorInsertNES-ZapCV5
TagsNuclear Export Signal (NES) derived from HIV-1ExpressionMammalianMutationECFP gene is truncated 36 bp at 3' end. Venu…PromoterCBAAvailable SinceJuly 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -