We narrowed to 18,888 results for: REV
-
Plasmid#233000PurposeGalactose iduced expression of Gcn4 WT 44merGFP in yeastDepositorInsertGcn4 WT 44mer
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 30mer
Plasmid#232986PurposeGalactose iduced expression of Gcn4 WT 30mer in yeastDepositorInsertGcn4 WT 30mer
TagsTEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 StoL
Plasmid#231882PurposeBacterial expression of N-terminally 6His tagged Gcn4 StoLDepositorInsertGcn4 StoL
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS104L, S117L, S136L, S144LPromoterT7Available SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 S/ArotoL
Plasmid#231880PurposeBacterial expression of N-terminally 6His tagged Gcn4 SArotoLDepositorInsertGcn4 S/ArotoL
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS101L, S104L, F108L, Y110L, S117L, S136L, S144LPromoterT7Available SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 L113A+
Plasmid#231873PurposeBacterial expression of N-terminally 6His tagged Gcn4 L113A+DepositorInsertGcn4 L113A+
Tags6xHis, TEV cleavage siteExpressionBacterialMutationL113A, E114Y, N126H, D127E, S136APromoterT7Available SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 E2K2
Plasmid#231868PurposeBacterial expression of N-terminally 6His tagged Gcn4 E2K2DepositorInsertGcn4 E2K2
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS104K, S117E, S136E, S144KPromoterT7Available SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 9acidA
Plasmid#231867PurposeBacterial expression of N-terminally 6His tagged Gcn4 9acidADepositorInsertGcn4 9acidA
Tags6xHis, TEV cleavage siteExpressionBacterialMutationE109A, E111A, E114A, D115A, E119A, D125A, D127A, …PromoterT7Available SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-NFAPorig
Plasmid#221091PurposeFAP insert for N-terminally tagging genes of interest (original FAP + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-NFAPorig
Plasmid#221086PurposeFAP insert for N-terminally tagging genes of interest (original FAP + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-CFAPorig
Plasmid#221087PurposeFAP insert for C-terminally tagging genes of interest (original FAP + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUGW-RUSH-Strep-KDEL
Plasmid#228527PurposeLentiviral vector, cloning vector for Strep-KDEL-IRES in mammalian cells.DepositorInsertStrep-KDEL
UseLentiviralTagsStreptavidin-KDELExpressionMammalianPromoterUbcAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Kan
Plasmid#232102PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg
Plasmid#232101PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 Aro3+
Plasmid#231884PurposeBacterial expression of N-terminally 6His tagged Gcn4 Aro3+DepositorInsertGcn4 Aro3+
Tags6xHis, TEV cleavage siteExpressionBacterialMutationD103Y, N112T, L113Y, S117F, K140RPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 Aro2+
Plasmid#231883PurposeBacterial expression of N-terminally 6His tagged Gcn4 Aro2+DepositorInsertGcn4 Aro2+
Tags6xHis, TEV cleavage siteExpressionBacterialMutationN116F, S117E, E119N, P129Q, T132YPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 WTSLFD
Plasmid#231881PurposeBacterial expression of N-terminally 6His tagged Gcn4 WTSLFDDepositorInsertGcn4 WTSLFD
Tags6xHis, TEV cleavage siteExpressionBacterialMutationF108W, E109T, Y110S, E111L, N112F, L113DPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 F108A+
Plasmid#231875PurposeBacterial expression of N-terminally 6His tagged Gcn4 F108A+DepositorInsertGcn4 F108A+
Tags6xHis, TEV cleavage siteExpressionBacterialMutationF108A, T121L, A141PPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 ILVtoED W
Plasmid#231871PurposeBacterial expression of N-terminally 6His tagged Gcn4 ILVtoED WDepositorInsertGcn4 ILVtoED W
Tags6xHis, TEV cleavage siteExpressionBacterialMutationN126W, I128E, V130E, V135E, L137D, I142DPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 ILVtoAS
Plasmid#231859PurposeBacterial expression of N-terminally 6His tagged Gcn4 ILVtoASDepositorInsertGcn4 ILVtoAS
Tags6xHis, TEV cleavage siteExpressionBacterialMutationL123S, I128S, V130A, V135A, L137S, I142SPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 ILVtoED
Plasmid#231857PurposeBacterial expression of N-terminally 6His tagged Gcn4 ILVtoEDDepositorInsertGcn4 ILVtoED
Tags6xHis, TEV cleavage siteExpressionBacterialMutationL123D, I128E, V130E, V135E, L137D, I142DPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Kif1A-EGFP-SNAP
Plasmid#229851PurposeKif1A (aa1-351)-Kif1A neck linker(17aa) fused to Kin1 coiled coil (aa345-406)-EGFP-SNAP-his. This Kif1A was used to link an oligo to the motor using the SNAP tag for single molecule experimentsDepositorAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PM-deltaCKAR
Plasmid#222429PurposeFRET-based reporter for monitoring deltaPKC activity at the plasma membrane in cells.DepositorInsertPlasma membrane delta-selective C kinase activity reporter
TagsCFP and YFPExpressionMammalianAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAV-CMVp-2xTetO-Tornado-1xALFATag-5xSunTag_codon_optimized-4x(6xAAA)
Plasmid#231603PurposeExpress circular RNA translation reporter with 1xALFATag-5xSunTag_codon_optimized-4x(6xAAA) under CMV promoterDepositorInsertTornado-1xALFATag-5xSunTag_codon_optimized-4x(6xAAA)
ExpressionMammalianAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAV-CMVp-2xTetO-Tornado-1xALFATag-5xSunTag_codon_optimized+8xAAA
Plasmid#231604PurposeExpress circular RNA translation reporter with 1xALFATag-5xSunTag_codon_optimized-8xAAA under CMV promoterDepositorInsertTornado-1xALFATag-5xSunTag_codon_optimized-8xAAA
ExpressionMammalianAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAV-H1promoter-2xTetO-Tornado-2xALFA-10xSunTag-Pseudoknot
Plasmid#231593PurposeExpress circular RNA translation reporter with 2xALFATag-10xSunTag-Pseudoknot under H1 promoterDepositorInsertTornado-2xALFATag-10xSunTag-Pseudoknot sequence
ExpressionMammalianAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-L1374
Plasmid#226278PurposePlasmid expressing the SSD1 allele from L-1374, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-ATG2A HRD
Plasmid#207540PurposeHomologous recombination donor to integrate a 3xFLAG-HaloTag at the endogenous ATG2A locus in human cellsDepositorInsertHaloTag flanked by human ATG2A locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pAM72
Plasmid#227622PurposepETDuet-1 Rpn8(1-179)-precission-Strep, H6-precission-Rpn11(2-239, G77P)DepositorTagsHis-PrescissionExpressionBacterialMutation1-179 and aa 2-239, G77PPromoterT7Available SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Nuc-deltaCKAR
Plasmid#222430PurposeFRET-based reporter for monitoring deltaPKC activity at the nucleus in cells.DepositorInsertNucleus delta-selective C kinase activity reporter
TagsCFP and YFPExpressionMammalianAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTet-F30-Pepper aptamer-UTR1-mTurq2
Plasmid#227645PurposepTet-driven expression of F30-scaffolded Pepper aptamer and mTurquoise2 for quantifying cell-free RNA and protein synthesis. The mTurq2 has a GGGGS linker followed by a His6x tag.DepositorInsertF30-scaffolded Pepper aptamer and mTurquoise2 (codon optimized for E. coli B using IDT Codon Optimizer)
UseSynthetic BiologyAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM315 pACYC-His6-Rpn10[ΔUIM]
Plasmid#226348PurposeExpression of yeast Rpn10 with the UIM deletedDepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Golgi-deltaCKAR
Plasmid#222428PurposeFRET-based reporter for monitoring deltaPKC activity at the Golgi in cells.DepositorInsertGolgi delta-selective C kinase activity reporter
TagsCFP and YFPExpressionMammalianAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgSeLEU2
Plasmid#224870PurposeDisruption of S. eubayanus type LEU2 genesDepositorInsertpYAMTr2GC having the guide sequence SeLEU2 (DI49_0736 Budding Yeast)
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP-AUG-IRES-mCherry
Plasmid#222109PurposeStart codon reporter (WT AUG)DepositorInsertGFP-IRES-mCherry
UseLentiviralAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1559
Plasmid#218590PurposeExpress peroxisomal Idi1p, Erg20(F96W,N127W)p, and GESp to convert IPP to geraniol with cytosolic Erg20 homodimerDepositorInsertGES
TagsePTS1ExpressionYeastMutationErg20(F96W, N127W), Erg20-Erg20 synthetic homodim…Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSF-coSnaA-TEV-His_His-TEV-SnaC
Plasmid#225059Purposerecombinant expression of SnaA in E. coliDepositorInsertSnaA
ExpressionBacterialPromoterT7Available SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ar2
Plasmid#225220PurposeExpression androgen receptor 2 in mammalian cellsDepositorInsertandrogen receptor 2
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
300_pETcon_SARS2_FLip
Plasmid#222230Purposeyeast surface display of the SARS-CoV-2 FLip variant RBDDepositorAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
297_pETcon_SARS2_Omicron-BA286
Plasmid#222231Purposeyeast surface display of the SARS-CoV-2 BA.2.86 variant RBDDepositorInsertSARS-CoV-2 BA.2.86 RBD (S Budding Yeast, SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
299_pETcon_SARS2_EG-5
Plasmid#222232Purposeyeast surface display of the SARS-CoV-2 EG.5 variant RBDDepositorAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSET-Cm-CspB
Plasmid#215400PurposeCm NCPPB382 cspB codon-optimized for E. coli recombinant protein expression (6xHis-CspB)DepositorInsertcspB
Tags6xHis TagExpressionBacterialPromoterT7 promoterAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSET-Cm-CspA2
Plasmid#215399PurposeCm NCPPB382 cspA2 codon-optimized for E. coli recombinant protein expression (6xHis-CspA2)DepositorInsertcspA2
Tags6xHis TagExpressionBacterialPromoterT7 promoterAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAV-puro-U6+27-F30-Tornado-Acyclovir-IRE#A4
Plasmid#216823PurposeExpresses acyclovir-controllable IRE variant #A4 as circular RNA in mammalian cells using the Tornado expression system.DepositorInsertTornado-Acyclovir-IRE#A4
ExpressionMammalianPromoterU6+27Available SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only