We narrowed to 4,466 results for: Abo;
-
Plasmid#156181PurposeCMV-driven expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterCMVAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pInducer20_SLC38A2_N82A
Plasmid#156183PurposeDox-inducible expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterTREAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
46_pAAV-ProC11-CatCh-GFP-WPRE
Plasmid#125946PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC11Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
11_pAAV-ProC6-CatCh-GFP-WPRE
Plasmid#125942PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC6Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
40_pAAV-ProC9-CatCh-GFP-WPRE
Plasmid#125944PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC9Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
95_pAAV-ProA28-CatCh-GFP-WPRE
Plasmid#125911PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA28Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
61_pAAV-ProA18-CatCh-GFP-WPRE
Plasmid#125901PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA18Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
5_pAAV-ProA9-CatCh-GFP-WPRE
Plasmid#125893PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA9Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
214_pAAV-ProD22-CatCh-GFP-WPRE
Plasmid#125998PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD22Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
159_pAAV-ProD3-CatCh-GFP-WPRE
Plasmid#125979PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD3Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-Puro
Plasmid#215362PurposeExpresses a rat Letm1 specific shRNADepositorInsertLetm1 shRNA Target sequence (Letm1 Rat)
UseLentiviralAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-mTagBFP2
Plasmid#215363PurposeExpresses a rat Letm1 specific shRNA and a BFP under a separate hPGK promoterDepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-miRFPnano
Plasmid#215365PurposeExpresses a rat Letm1 specific shRNA and miRFPnano under a separate hPGK promoterDepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mito4x-GCaMP6f-IRES2-rat-Letm1
Plasmid#212661PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and rat-Letm1DepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mito4x-GCaMP6f-Drosophila-Letm1
Plasmid#212663PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and Drosophila-Letm1DepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_12S→E_S305C/A326P
Plasmid#248868PurposeExpresses MBP-tagged C-terminal domain of TDP-43 with 12S→E, S305C and A326P.DepositorInsertTDP-43_CTD_12S→E_S305C/A326P (TARDBP Human)
Tags6xHis tags-MBPExpressionBacterialMutationchanged S292E, S369E, S377E, S379E, S387E, S389E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_13S→E_S317C
Plasmid#248845PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with 13S→E and S317C.DepositorInsertTDP-43_CTD_13S→E_S317C (TARDBP Human)
Tags6xHis-tagsExpressionBacterialMutationchanged S292E, S305E, S369E, S377E, S379E, S387E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_13S→E_S273C
Plasmid#248859PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with 13S→E and S273C.DepositorInsertTDP-43_CTD_13S→E_S273C (TARDBP Human)
Tags6xHis-tagsExpressionBacterialMutationchanged S292E, S305E, S369E, S377E, S379E, S387E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_12S→E_S305C
Plasmid#248867PurposeExpresses MBP-tagged C-terminal domain of TDP-43 with 12S→E and S305C.DepositorInsertTDP-43_CTD_12S→E_S305C (TARDBP Human)
Tags6xHis tags-MBPExpressionBacterialMutationchanged S292E, S369E, S377E, S379E, S387E, S389E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only