We narrowed to 3,547 results for: ttl
-
Plasmid#118412PurposeExpresses firefly luciferase under the control of a strong ubiquitous promoter EF1a along with a WPRE cassette. Backbone is compatible with both baculoviral and human production methods of AAV.DepositorInsertFirefly luciferase
UseAAV, Luciferase, and Synthetic BiologyExpressionInsect and MammalianPromoterEF1aAvailable SinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ284-RVRR
Plasmid#160327PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized Mb2Cas12a with N563R, K569V, N573R and K625R mutations, without promoterDepositorInsertMb2Cas12a RVRR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN563R, K569V, N573R and K625RAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC6A4
Plasmid#132172PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC6A4 (SLC6A4 Human)
ExpressionMammalianAvailable SinceOct. 25, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTU1-A-pdh_RiboJ_GFP+_MGApt_Bba_B0015
Plasmid#107576PurposeB. megaterium DSM319 pdh promoter, GFP+ with malachite green mRNA aptamer in Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertGFP+
UseSynthetic BiologyTagsB. megaterium DSM319 xylA leader sequence (MTSSKI…ExpressionBacterialMutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163APromoterpdh promoter Bacillus megaterium DSM319Available SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
TH1259-014_Jie_EWSR1_pOCC119_pOEM1-N-HIS6-MBP-NotI-AscI-C-TEV-mGFP
Plasmid#221894PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertEWSR1 (EWSR1 Human)
Tags6xHis-MBP-PreScission and TEV-mGFPExpressionInsectMutationwtPromoterPH promoterAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ284-RVR
Plasmid#138117PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized Mb2Cas12a with N563R, K569V and N573R mutations, without promoterDepositorInsertMb2Cas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN563R, K569V and N573RAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOEM1_pCMV:bmp4-pPH:vsvged
Plasmid#111157PurposeBaculovirus rescue vector, VSVGED pseudotype, hShhDepositorInserthBmp4 (BMP4 Human)
UseBaculoviral rescue shuttle vectorExpressionInsect and MammalianMutationwtPromoterCMVAvailable SinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ289-RVR
Plasmid#138127PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized ErCas12a with D513R, K519V and N523R mutations, without promoterDepositorInsertErCas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationD513R, K519V and N523RAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HES5
Plasmid#101409PurposeDonor Vector containing HES5 transcription factor, part of the Human TFome CollectionDepositorInsertHES5 (HES5 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
TH1274-054_Jie_EWSR1_pOCC177_pOEM1-N-HIS-MBP-PS-NotI-AscI-TEV-SNAP
Plasmid#221896PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertEWSR1 (EWSR1 Human)
Tags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationwtPromoterPH promoterAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF385A
Plasmid#101615PurposeDonor Vector containing ZNF385A transcription factor, part of the Human TFome CollectionDepositorInsertZNF385A (ZNF385A Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXD4L3
Plasmid#101491PurposeDonor Vector containing FOXD4L3 transcription factor, part of the Human TFome CollectionDepositorInsertFOXD4L3 (FOXD4L3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF197
Plasmid#101547PurposeDonor Vector containing ZNF197 transcription factor, part of the Human TFome CollectionDepositorInsertZNF197 (ZNF197 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ287-RVR
Plasmid#138124PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized BsCas12a with N512R, K518V and N522R mutations, without promoterDepositorInsertBsCas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN512R, K518V and N522RAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ285-RVR
Plasmid#138121PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized Lb5Cas12a with N512R, K518V and N522R mutations, without promoterDepositorInsertLb5Cas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN512R, K518V and N522RAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-fbp_RiboJ_GFP+_MGApt_Bba_B0015
Plasmid#107578PurposeB. megaterium DSM319 fbp promoter, GFP+ with malachite green mRNA aptamer for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertGFP+
UseSynthetic BiologyTagsB. megaterium DSM319 xylA leader sequence (MTSSKI…ExpressionBacterialMutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163APromoterfbp promoter Bacillus megaterium DSM319Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-GATA6
Plasmid#101418PurposeDonor Vector containing GATA6 transcription factor, part of the Human TFome CollectionDepositorInsertGATA6 (GATA6 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-GATA4
Plasmid#101417PurposeDonor Vector containing GATA4 transcription factor, part of the Human TFome CollectionDepositorInsertGATA4 (GATA4 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC6A4_STOP
Plasmid#161338PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC6A4 (SLC6A4 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only