We narrowed to 3,570 results for: lenti crispr cas9 plasmids
-
Plasmid#155068PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_antiCD19_H1_Gal4VP64
Plasmid#169918PurposeExpression of a synNotch receptor containing antiCD19, a human Notch1 core, and Gal4VP64.DepositorInsertantiCD19-Notch1-GL4VP64
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_antiCD19_Z3_Gal4VP64
Plasmid#169916PurposeExpression of a synNotch receptor containing antiCD19, a zebrafish Notch core and Gal4VP64.DepositorInsertantiCD19-Notch3-GL4VP64
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
ScFv-2ERT2-VPH
Plasmid#120556PurposeEncode an antibody that binds to the GCN4 peptide from the SunTag system, and is fused to 2 tandem ERT2, VP64, P65 and HSF1DepositorInsertscFvGCN4, GB1, ERT2, VP64, P65 and HSF1
UseLentiviralExpressionMammalianPromoterhPGKAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
ScFv-2ERT2-V
Plasmid#120553Purpose3rd gen transfer vector. Encode an antibody that binds to the GCN4 peptide from the SunTag system, and is fused to sfGFP, 2 tandem ERT2 and VP64.DepositorInsertscFvGCN4, sfGFP, GB1, ERT2, VP64
UseLentiviralExpressionMammalianPromoterhPGKAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Wei lab paired-guide RNA (pgRNA) CRISPR–Cas9 library for human long non-coding RNAs (lncRNAs)
Pooled Library#89640PurposeDesigned for genomic deletion screening of functional lncRNAs (long non-coding RNAs) using lentiviral pgRNAs (paired-guide RNAs).DepositorExpressionMammalianUseLentiviralAvailable SinceMay 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lv EF1a MS2-Fkbp2x 2A Hygro
Plasmid#102807PurposeLentiviral plasmid from FIRE-Cas9 system to express MS2-Fkbp2x fusion proteinDepositorInsertMS2-Fkbp2x
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lv EF1a MS2-Fkbp1x 2A Hygro
Plasmid#102806PurposeLentiviral plasmid from FIRE-Cas9 system to express MS2-Fkbp1x fusion proteinDepositorInsertMS2-Fkbp
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lv EF1a MS2-HP1cs 2A Hygro
Plasmid#102810PurposeLentiviral plasmid from FIRE-Cas9 system to express MS2-HP1cs fusion proteinDepositorInsertMS2-HP1cs
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lv EF1a SS18-Frb PGK Puro
Plasmid#102811PurposeLentiviral plasmid from FIRE-Cas9 system to express SS18-Frb fusion proteinDepositorInsertSS18-Frb
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lv EF1a HP1cs-Frb1x PGK Puro
Plasmid#102808PurposeLentiviral plasmid from FIRE-Cas9 system to express HP1cs-Frb1x fusion proteinDepositorInsertHP1cs-Frb1x
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lv EF1a HP1cs-Frb2x PGK Puro
Plasmid#102809PurposeLentiviral plasmid from FIRE-Cas9 system to express HP1cs-Frb2x fusion proteinDepositorInsertHP1cs-Frb2x
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_3
Plasmid#155083PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_1
Plasmid#155081PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only