We narrowed to 8,464 results for: Dos;
-
Plasmid#158029PurposeThis is a dual function destination vector for eSTARR-seq and luciferase assay to quantify enhancer activity. It contains an SCP1 promoter, a luciferase CDS, followed by a Gateway cassette (R2-R1).DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianPromoterSCP1 (Super Core Promoter 1)Available SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pDEST-hSTARR-luc-Pmyc
Plasmid#157874PurposeThis is a dual function destination vector for eSTARR-seq and luciferase assay to quantify enhancer activity. It contains a MYC promoter, a luciferase CDS, followed by a Gateway cassette (R1-R2).DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianPromoterMYCAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB
Plasmid#236763PurposeA piggybac-based cloning vector containing mouse U6 promoter-driven sgRNA for spCas9 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorTypeEmpty backboneUsePiggybacExpressionMammalianPromotermouse U6 promoter, CAG promoterAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-2G-CNCB
Plasmid#236764PurposeA piggybac-based cloning vector containing dual sgRNAs for spCas9 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorTypeEmpty backboneUsePiggybacExpressionMammalianPromotermouse U6 promoter, human U6 promoter, CAG promoterAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA FLAG p85beta
Plasmid#237336Purposetransient overexpression in mammalian cellsDepositorAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJExpress401-KDAC8
Plasmid#224208PurposeExpresses human KDAC8 (HDAC8) in E. coliDepositorAvailable SinceDec. 6, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-myc-GFP-TNRC6A-SD-WT
Plasmid#215897PurposeExpression of TNRC6A-silencing domain (SD)DepositorAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-myc-GFP-TNRC6A-SD-CIM1-WT
Plasmid#215898PurposeExpression of TNRC6A-CIM1 domainDepositorAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-myc-GFP-TNRC6A-SD-CIM2-WT
Plasmid#215899PurposeExpression of TNRC6A-CIM2 domainDepositorAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBa.KIF13B
Plasmid#224413PurposeMammalian expression of Kif 13bDepositorAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBa.KIF13A
Plasmid#224408PurposeMammalian expression of Kif 13aDepositorAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
300_pETcon_SARS2_FLip
Plasmid#222230Purposeyeast surface display of the SARS-CoV-2 FLip variant RBDDepositorAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
297_pETcon_SARS2_Omicron-BA286
Plasmid#222231Purposeyeast surface display of the SARS-CoV-2 BA.2.86 variant RBDDepositorInsertSARS-CoV-2 BA.2.86 RBD (S SARS-CoV-2 virus, Budding Yeast)
TagsHA and c-MycExpressionYeastAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
299_pETcon_SARS2_EG-5
Plasmid#222232Purposeyeast surface display of the SARS-CoV-2 EG.5 variant RBDDepositorAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDM097
Plasmid#216819PurposeAspergillus nidulans codon-adjusted mStayGold fluorescent protein, includes linker for N-terminal or internal tagging.DepositorInsertmStayGold
TagsFLAG-(SGGS)x2-XTEN16-(GGGGS)x3 and c4-(GGGGS)x2-X…ExpressionBacterialMutationAspergillus nidulans codon-adjustedAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBa.Mark2-3myc
Plasmid#224416PurposeMammalian expression of MARK2DepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEXP(FLAG/HA-NSP1-WT)
Plasmid#188781PurposeExpresses FLAG/HA-NSP1 in mammalian cells (SARS-CoV-2 NSP1)DepositorInsertFLAG/HA-NSP1 (SARS-CoV-2)
UseFrt site to insert into hek293 t-rex genomeTagsFLAG/HAExpressionMammalianPromoterCMV Dox inducibleAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
T7-LacO-Halo-PILATeS-RGD (200nM)
Plasmid#216716PurposeExpresses HaloTag-PILATeS-RGD with 200 nM BiT tag in bacteriaDepositorInsertHaloTag-PILATeS-RGD
Tags6xHis and HaloTagExpressionBacterialAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only