We narrowed to 14,230 results for: Ada;
-
Plasmid#71267PurposeEntry clone containing the GUS enzyme. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertBeta-glucuronidase
UseGatewayTags2xGly linker and octaline synthase terminatorExpressionMutationPromoterAvailable sinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAVA-Gal11p-LGF2(fs)
Plasmid#127482PurposeNegative control for the AVA-seq system. Gal11p (lambda CI associated) and LGF2 (with one nucleotide insertion) (RNAp associated) interactionDepositorInsertGal11p-LGF2(frame shifted) (GAL11 Budding Yeast)
UseTagsExpressionBacterialMutationLGF2 is frame shifted by the insert of one nucleo…PromoterAvailable sinceNov. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-SM
Plasmid#136578PurposeDox-inducible polycistronic lentiviral vector expressing mouse Sox2, cMycDepositorUseLentiviralTagsExpressionBacterialMutationPromotertetO-miniCMV (dox-inducible)Available sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX307 DEDD
Plasmid#117744PurposeOpen reading frame vector encoding DEDDDepositorInsertDEDD1 (DEDD Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterEF1aAvailable sinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AvicFP4
Plasmid#129507PurposeExpresses AvicFP4 constitutively in E. coli (most strains)DepositorInsertAvicFP4
UseTagsExpressionBacterialMutationOne of two variants of AvicFP4 tested with essent…Promotersynthetic constitutive (stationary phase) promote…Available sinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry-C1-Aurora
Plasmid#98167Purposered-shifted artificial anion conducting channelrhodopsin (aACR). Activation up to 600 nm; off-kinetics 260 ms. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Aurora gene
UseTagsmCherryExpressionMammalianMutationV59S, E83N, E90Q, E101S, V117R, E123S, P242R, A24…PromoterCMV (+enhancer)Available sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBItetDT240GFP
Plasmid#96904Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 240 interrupted CTG repeats in exon 15 locatedDepositorInsertEGFP and human DMPK exons 11-15 with 240 interrupted CTG repeats (DMPK Human)
UseTetracycline responsive and bidirectionalTagsExpressionMammalianMutationPromotertetracycline responsive and bidirectionalAvailable sinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTIGER_tdTomato::3xFLAG::dCrk
Plasmid#131138PurposeUASp construct for over-expression of Drosophila Crk with N-terminal tandem Tomato and 3X FLAG tag. Compatible with PhiC31-mediated site-specific integration or classical P-element insertion.DepositorInsertCrk (Crk Fly)
UseTags3XFLAG and tdTomatoExpressionInsectMutationPromoterAvailable sinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
S1 1029 CP ABEMax strategy 1
Plasmid#135357PurposeExpression of circular permutant of nSpyCas9 at amino acid position 1029 encoding ABEMax (wildtype Tada monomer coupled with evolved Tada monomer) at the N-terminusDepositorInsertABEMax-nSpyCas9 aa 1029
UseCRISPRTagsExpressionMammalianMutationWTPromoterAvailable sinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKK-NoTag
Plasmid#105767PurposeControl vector for pKK series (encodes only SLIC arms (TEV-L and TEV-R)); expression without tag. Useful to design other vectors; any tag can be added.DepositorTypeEmpty backboneUseFlp-in competentTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
mP58.dJ1-pCDNA3
Plasmid#21884DepositorInsertP58 (Dnajc3 Mouse)
UseTagsExpressionMammalianMutationDnaJ domain deleted from C-termPromoterAvailable sinceSept. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
mCherry-hPMCA2xb
Plasmid#47751Purposemammalian expression of mCherry tagged hPMCA2, xb splice variantDepositorInsertPMCA2x/b (ATP2B2 Human)
UseTagsmCherryExpressionMammalianMutationxb splice variantPromoterCMVAvailable sinceNov. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-T0-Flag-HROB
Plasmid#135298PurposeExpresses Flag-tagged HROB in mammalian cellsDepositorInsertHROB (HROB Human)
UseTagsFlagExpressionMammalianMutationPromoterCMVAvailable sinceMarch 2, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHAGE2-TetOminiCMV-Klf4
Plasmid#136613PurposeDox-inducible lentiviral vector expressing mouse Klf4DepositorInsertKlf4 (Klf4 Mouse)
UseLentiviralTagsExpressionBacterialMutationPromotertetO-miniCMV (dox-inducible)Available sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKK-FLAG-TEV
Plasmid#105768PurposeExpression of your protein of interest in fusion with FLAG at the N-terminus. The tag is cleavable by TEV protease or enterokinase.DepositorTypeEmpty backboneUseFlp-in competentTagsFLAG-TEVExpressionMammalianMutationPromoterAvailable sinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-APPL1-R146A/K152A/R154A
Plasmid#59767PurposeExpresses APPL1 Endosomal Localization MutantDepositorInsertAPPL1 (APPL1 Human)
UseTagsEGFPExpressionMammalianMutationR146A/K152A/R154APromoterCMVAvailable sinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSG5-FLAG-mEKLF
Plasmid#67833PurposeExpression of FL-EKLF driven by SV40 promoterDepositorInsertEKLF (Klf1 Mouse)
UseTagsFLAGExpressionMammalianMutationFull-length mEKLF is aa 20-376; amino acid 19 is …PromoterSV40Available sinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV2_hSyn_Phobos_Citrine
Plasmid#98216PurposeBlue-shifted artificial anion conducting channelrhodopsin (aACR). Activation max 466 nm; off-kinetics 10 ms. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Phobos gene
UseAAVTagsCitrineExpressionMammalianMutationT59S, E83N, E90Q, E101S, V117R, E123S, T159G, G16…Promoterhuman synapsinAvailable sinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1TGt
Plasmid#44508DepositorInsertsUseSynthetic Biology; Expression regulator/reporterTagsExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable sinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only