We narrowed to 44,227 results for: gats
-
Plasmid#224506PurposeGateway compatible middle entry clone containing a Destablized LexA and LexOperon with 3' minimal c-Fos promoter for an all in one RU486 driven gene expression constructDepositorInsertLexA-oMDC-LexOP-c-Fos
UseGateway cloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-lox-3xNLS-mCherry-V5-SV40pA-3xstop-lox (JDW 1232)
Plasmid#224522PurposeA Gateway compatible middle entry clone containing loxP flanked 3xNLS-mCherry-V5-3xSTOP cassetteDepositorInsertlox-3xNLS-mCherry-V5-SV40pA-3xstop-lox
UseCre/LoxAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-Lb
Plasmid#209028PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-As
Plasmid#209032PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-mOrange/CALR ins5
Plasmid#214769PurposeMammalian expression of human CALR ins5DepositorAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-RBMS3
Plasmid#185557PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting RBMS3DepositorInsertRBMS3 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-ADGRG6
Plasmid#185554PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting ADGRG6DepositorInsertADGRG6 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 ATG3 C264A
Plasmid#129293PurposeGateway entry clone encoding human ATG3 C264A (catalytic inactive)DepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseGateway entry vector / entry cloneMutationchanged Cysteine 264 to AlanineAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 ATG3 allKR
Plasmid#129295PurposeGateway entry clone encoding human ATG3 with all 22 lysine residues mutated to arginineDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseGateway entry vector / entry cloneMutationchanged all 22 Lysine residues to ArginineAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP082
Plasmid#103875PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces marxianusDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces marxianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP025
Plasmid#103874PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces lactisDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces lactis
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
TFORF2237
Plasmid#141983PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUDP002
Plasmid#103872PurposeBroad-host-range Cas9/gRNA co-expression backbone plasmid (no gRNA)DepositorInsertshph
Spcas9 D147Y P411T
UseCRISPRTagsNLSExpressionYeastMutationD147Y P411TPromoterArxula adeninivorans TEF1 and Ashbya gossypii (Er…Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC35A2
Plasmid#132147PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC35A2 (SLC35A2 Human)
ExpressionMammalianAvailable SinceNov. 25, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
TFORF2238
Plasmid#142177PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2236
Plasmid#141982PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC18A1_STOP
Plasmid#161151PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC18A1 (SLC18A1 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUCIDT-attL1-Human ABeta-attR5
Plasmid#160436PurposeEntry vector for cloning human Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Human)
ExpressionBacterialAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only