We narrowed to 821 results for: mcherry reporter
-
Plasmid#220800PurposeLentivirus expressing mutant tRNA synthetase for incorporation of noncanonical amino acids in nascent proteins plus mCherry reporter and puro resistanceDepositorInsertMars1 (Mars1 Mouse)
UseLentiviralTags2xFLAG and T2A-mCherryMutationmutation in MetRS to change aa 274 from L to GPromoterEF1aAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-VEGF120-T2A-mCherry
Plasmid#229134PurposeRetrovirus driving overexpression of VEGF120 plus mCherry reporterDepositorAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV mCherry-GFP-LC3B G120A
Plasmid#123235PurposeExpresses mCherry-EGFP-LC3B G120A in mammalian cells. Negative control for tandem reporter. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianMutationGlycine 120 to AlaninePromoterCMVAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcs2-MTS-cox8A-GFP-IRES-mCherry
Plasmid#226103PurposeStability reporter construct of the COX8A mitochondrial targeting sequence (MTS) for transient expression in mammalian cellsDepositorInsertCOX8A (COX8A Human)
TagsGFPExpressionMammalianMutationencodes only for mitochondrial targeting sequence…Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-Hsp-Fluc-PGK-Rluc-mCherry
Plasmid#191863PurposeHeat inducible Fluc reporter with constitutive RlucDepositorInsertsFirefly luciferase Fluc
Renilla luciferase Rluc
UseLentiviralTagsP2A-mCherryExpressionMammalianPromoterHSPA7 promoter and PGK promoterAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-DIO-TRPV1-P2A-mCherry
Plasmid#200831PurposeIn the presence of Cre, drives neuron-specific expression of TRPV1 with fluorescence reporter mCherryDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJET-CMV-GFP-P2A-K0-P2A-mCherry
Plasmid#185619PurposeRibosomal stalling reporter: emptyDepositorInsertGFP-empty-mCherry
ExpressionMammalianPromoterCMVAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7751 pHR Ef1α: mCherry-P2A-AcrIIA4
Plasmid#125148PurposeLentiviral vector for constitutive expression of AcrIIA4 with mCherry fluorescent reporter.DepositorInsertAcrIIA4-P2A-mCherry
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiX_(loxPconDIAL-YB_TATA)-mCherry-HRasG12V-BGH_pKG3906
Plasmid#246345PurposeloxPcon DIAL Reporter Lentivirus expressing mCherry-HRasG12V in the presence of ZFaDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD1112 TRE-mCherry-SKL-22Xm6A MS2
Plasmid#235128PurposemCherry reporter plasmid for live cell visualization of RNA m6A modificationDepositorInsertTRE-mCherry-SKL-22Xm6A MS2
UseLentiviralExpressionMammalianAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4TO F8.2(S54L+T127A)-T2A-mCherry
Plasmid#225586PurposeMammalian expression vector for Doxycycline inducible expression of F8.2(S54L+T127A) anti-tau nanobody with a self-cleaving T2A-mCherry fluorescent expression reporterDepositorInsertF8.2(S54L+T127A)-T2A-mCherry
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcs2-Δhel1/Δhel2HRI-GFP-IRES-mCherry
Plasmid#226101PurposeHRI stability reporter construct with deletion of SIFI degron helices 1&2 for transient expression in mammalian cellsDepositorInsertHRI (EIF2AK1 Human)
TagsGFPExpressionMammalianMutationSIFI degron helices 1 & 2 deleted (Δ61-112)Available SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcs2-N-HRI(1-138)-GFP-IRES-mCherry
Plasmid#226100PurposeHRI N-terminal region (residues 1-138) stability reporter construct for transient expression in mammalian cellsDepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-Lifeact-mCherry-3xHA (JDW 1321)
Plasmid#224493PurposeGateway compatible middle entry clone containing Lifeact-mCherry (RFP F-actin reporter)DepositorInsertLifeact-mCherry-3xHA
UseGateway cloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcs2-ATF4uORF1-2-GFP-IRES-mCherry
Plasmid#226105PurposeATF4uORF1-2 stability reporter construct with deletion of SIFI degron helices 1&2 for transient expression in mammalian cells to read out activation of the integrated stress response (ISR)DepositorInsertatf4 (ATF4 Human)
TagsGFPExpressionMammalianMutationcontains uORF1-2 of ATF4, whose stability can ser…Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRAF-V600E-IRES-mCherry
Plasmid#221026PurposeFluorescent reporter for expressing a segment of BRAF-V600E CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-rev(CMV-TagBFP2)-EFS-mCherry-206-MRE
Plasmid#235156PurposeExpresses the mCherry-based sensor for miR-206. TagBFP2 is expressed as a transduction reporterDepositorInsertmCherry with a miR-206 MRE from Tpm4
UseAAVPromoterEFSAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-rev(CMV-TagBFP2)-EFS-mCherry-133-MRE
Plasmid#235157PurposeExpresses the mCherry-based sensor for miR-133. TagBFP2 is expressed as a transduction reporterDepositorInsertmCherry with a miR-133 MRE from Ankrd28
UseAAVPromoterEFSAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-rev(CMV-TagBFP2)-EFS-mCherry-137-MRE
Plasmid#235160PurposeExpresses the mCherry-based sensor for miR-137. TagBFP2 is expressed as a transduction reporterDepositorInsertmCherry with a miR-137 MRE from Neurod4
UseAAVPromoterEFSAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only