We narrowed to 3,890 results for: 28
-
Plasmid#123325PurposeLentiviral vector for expression of shRNA targeting IKZF1 from a miR30 embedded casette in the 3'UTR of ZsGreen-P2A-Puro insertDepositorInsertshRNA targeting IKZF1 embedded in miR30 backbone (IKZF1 Human)
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-CSNK1A1 G40N-P2A-Blast
Plasmid#123321PurposeLentiviral vector for expression of Flag tagged CK1alpha G40N-P2A-Blast casette from a CMV promoterDepositorInsertCSNK1A1 (CSNK1A1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationchanged Glycine 40 to AsparaginePromoterCMVAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
[pSK481] pLJC5 Flag-Depdc5(B)
Plasmid#109339PurposeLenti-viral expression of Flag-tagged Depdc5 mutant BDepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
[pSK479] pLJC5 Flag-Depdc5(C)
Plasmid#109340PurposeLenti-viral expression of Flag-tagged Depdc5 mutant CDepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Flag-Sesn-C mSesn2 (delAB)
Plasmid#111799PurposeMammalian Expression of mSesn2DepositorAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Flag-Sesn-B+C mSesn2 (delA)
Plasmid#111798PurposeMammalian Expression of mSesn2DepositorAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1[GalS-T]
Plasmid#60753PurposeContains PIq driving expression GalS-T, the Fucose inducible chimera with the TAN DBD.DepositorInsertsGalS-T
GalS-T
UseSynthetic BiologyExpressionBacterialMutationChimeric LacI/GalR repressor with the TAN DBD and…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[GalS-L,RbsR-L]
Plasmid#60763PurposeContains PIq driving expression GalS-L, and PIq driving expression of RbsR-L.DepositorInsertsGalS-L
RbsR-L
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. LacI DBD with GalS L…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[GalS-L,FruR-L]
Plasmid#60764PurposeContains PIq driving expression GalS-L, and PIq driving expression of FruR-L.DepositorInsertsGalS-L
FruR-L
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. LacI DBD with FruR L…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[GalS-L,TreR-L]
Plasmid#60765PurposeContains PIq driving expression GalS-L, and PI driving expression of TreR-L.DepositorInsertsGalS-L
TreR-L
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. LacI DBD with GalS L…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[FruR-L,RbsR-L]
Plasmid#60761PurposeContains PIq driving expression TreR-L, and PIq driving expression of RbsR-LDepositorInsertsFruR-L
RbsR-L
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. LacI DBD with FruR L…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[RbsR-L,TreR-L]
Plasmid#60766PurposeContains PIq driving expression RbsR-L, and PI driving expression of TreR-L.DepositorInsertsRbsR-L
TreR-L
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. LacI DBD with RbsR L…Available SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-hUL
Plasmid#27080PurposeIntegration-free (episomal) expression of human L-MYC and LIN28DepositorAvailable SinceMarch 10, 2011AvailabilityAcademic Institutions and Nonprofits only