We narrowed to 8,680 results for: aav
-
Plasmid#194881PurposeRatiometric YDA sensor for in vivo cre-dependent neuron-specific cholesterol visualizationDepositorInsertGFP-T2A-mCherry-YDA
UseAAV and Cre/LoxExpressionMammalianPromoterhuman SynapsinAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE-GFP-TurboID-HA-rtTA
Plasmid#226996PurposeIntegrative plasmid to express GFP-TurboID in mammalian cellsDepositorAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Afp
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgLacZ-U6-sgGFP-hSyn1-mCherry
Plasmid#208834PurposeControl plasmid expresses mCherry under the hSyn1 promoter with sgRNAs against LacZ and GFPDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgMap3K12(1)-U6-sgMap3K12(2)-hSyn1-mCherry
Plasmid#208835PurposeKnockout of Map3K12 (DLK) using tandem sgRNAs, expresses mCherry under the hSyn1 promoterDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgMap3K13(1)-U6-sgMap3K13(2)-hSyn1-mCherry
Plasmid#208836PurposeKnockout of Map3K13 (LZK) using tandem sgRNAs, expresses mCherry under the hSyn1 promoterDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgMap3K13(1)-U6-sgMap3K12(1)-hSyn1-mCherry
Plasmid#208837PurposeKnockout of Map3K12 (DLK) and Map3K13 (LZK) using tandem sgRNAs, expresses mCherry under the hSyn1 promoterDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_dCas9-XTEN-KRAB-p2A-GFP
Plasmid#222108PurposeDonor vector for CRISPRi integration at AAVS1 with a GFP fluorophoreDepositorInsertCRISPRi-kox1(KRAB) (cas9 Human, S. pyogenes)
UseAAV and CRISPRTagsHA and P2A-GFPExpressionMammalianMutationD10A, H840AAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgPet-1-hSyn-mCherry-KASH
Plasmid#223227PurposeguideRNA targeting the mouse Pet-1 (Fev)DepositorInsertFev (Fev Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1302-AAV-EFSNC-dCjCas9-KRAB
Plasmid#223147PurposeExpression of KRAB with dCjCas9 and empty gRNA scaffoldDepositorInsertKRAB
UseAAV and CRISPRTags3xFLAGExpressionMammalianPromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tnnt2-Cre-U6-Lmna-sgRNA
Plasmid#206178PurposeExpresses Cre recombinase specifically in cardiomyocytes and uses U6 promoter to express sgRNAs targeting murine Lmna exon 10DepositorInsertCre
UseAAVPromotercTnTAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Loxp-CMV-Loxp-GFP-LA
Plasmid#206199PurposeExpresses GFP-lamin-A only in non-myocyte when delivered into mice carrying a cardiomyocyte-specific Myh6-Cre transgeneDepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1312-AAV-EFSNC-dSaCas9-KRAB
Plasmid#223157PurposeExpression of KRAB with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB
UseAAV and CRISPRTags3xFLAGExpressionMammalianPromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-IvfChr-citrine-KV2.1
Plasmid#221615PurposeA recombinant AAV2 plasmid encoding vfChrimson-citrine with trafficking enhancement and soma targeting with KV2.1 motif.DepositorInsertvfChrimson-citrine with membrane trafficking enhancement and soma targeting
UseAAVMutationvfChrimson-citrine with membrane trafficking enha…PromoterHuman SynapsinAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipT-mScarlet-KV2.1
Plasmid#221617PurposeA recombinant AAV2 plasmid encoding the ZipACR I151V mutant and soma targeting with KV2.1 motif.DepositorInsertZipACR (I151T)-mScarlet with soma targeting
UseAAVMutationZipACR (I151T) with soma targetingPromoterHuman SynapsinAvailable SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipV-mScarlet-KV2.1
Plasmid#221616PurposeA recombinant AAV2 plasmid encoding the ZipACR I151T mutant and soma targeting with KV2.1 motif.DepositorInsertZipACR (I151V)-mScarlet with soma targeting
UseAAVMutationZipACR (I151V) with soma targetingPromoterHuman SynapsinAvailable SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-PiGM-Iq(D387A eGFP)
Plasmid#221603PurposeA recombinant AAV2 plasmid encoding the light insensitive PiGM-Iq system with CRY2PHR(D387A), CIBN and EGFP as expression marker. hSynapsin promoter for panneuronal expression.DepositorInsertPiGM-Iq (D387A, eGFP)
UseAAVMutationRGS2 1-53 truncation, CRYPHR D387APromoterHuman SynapsinAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-ArgiNLS-mVenus-Q69M(ME)
Plasmid#220597PurposeConstitutive expression of a single-cell discriminating version of mVenus-Q69M (ME) fluorescent protein.DepositorInsertmVenus-Q69M (ME)
UseAAVTagsArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GCaMP6f-WPRE
Plasmid#216275PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of green fluorescent calcium indicator GCaMP6fDepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman Synapsin 1 (hSyn)Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only