We narrowed to 20,235 results for: ATO
-
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-NS1
Plasmid#175276PurposeAAV vector mediating bicistronic expression of NS1 gene of YFV-17D and dTomato with NLSDepositorInsertNonstructural protein 1 (NS1) of YFV-17D; NLS-dTomato (POLY Yellow fever virus strain 17D)
UseAAVTagsNLS-dTomato (P2A cleavage)PromoterSynapsinAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-HemmarR
Plasmid#31222DepositorInsertCD4-tdTom (CD4 Aequorea victoria, Human, Fly)
TagsCD4 and tdTomatoExpressionInsectMutationFusion of signal peptide of Drosophila Akh gene, …Available SinceOct. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast HA-POLE2
Plasmid#160809PurposeExpress HA-tagged POLE2DepositorAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLJM1 flag-cFLIP
Plasmid#211529PurposeExpresses flag-tagged cFLIP (CFLAR)DepositorAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPP5912
Plasmid#128703PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) and chaperone Gateway donor cloneDepositorInsertshcE-avrE1
ExpressionBacterialMutationThree synonymous mutations Ala 362 (GCT-GCC), Ala…Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pQE80L-SpyCatcher-ELP-GFP
Plasmid#69835PurposeBacterial expression plasmid containing SpyCatcher-ELP-GFP fusion. SpyCatcher forms a covalent bond with SpyTag and can be used to label plasma membrane localized SpyTag-C1C2 in live cells.DepositorInsertSpyCatcher-ELP-GFP
Tags6x His Tag, GFP, and TEV TagExpressionBacterialPromoterT5 promoter/lac operator elementAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-REX-GECO1
Plasmid#61248PurposeExpresses REX-GECO1 in neuronsDepositorInsertREX-GECO1
UseAAVExpressionMammalianMutationSubstitutions relative to R-GECO1: P60R, V61W, R6…PromoterhSynAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAGIG-H2B-V5-mScarlet
Plasmid#191093PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsertH2B and mScarlet
UseAAVTagsH2B-V5-mScarletExpressionMammalianMutationThe fusion protein was optimized to the Human cod…PromoterCMV and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB_Cdc42-TomKat-sensor-CAAX
Plasmid#172473PurposePiggybac vector for mammalian expression of TomKat (tdTomato-tdKatushka) FRET sensor for Cdc42 activity anchored to the membrane with the polybasic and CAAX motif from Kras.DepositorInserttdKatushka2-PBD(Pak1)-EVlinker-Cdc42-tdTomato-CAAX
UsePiggybac transposonTagspolybasic and CAAX motif from Kras, tdKatushka2, …ExpressionMammalianPromoterCAGAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai27
Plasmid#34630PurposeCre-dependent expression of hChR2(H134R)-tdTomato, for optogenetic excitationDepositorInsertFloxed hChR2(H134R)-tdTomato
UseMouse TargetingTagstdTomatoMutationHis 134 has been mutated to ArgPromoterCAGAvailable SinceFeb. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
HT111_Fsyn_FAS(Cre off)_QuasAr6a_Citrine
Plasmid#178824PurposeNeuronal expression (Cre-off) of an archaerhodopsin-derived genetically encoded voltage indicator QuasAr6b carrying a Citrine expression tagDepositorInsertQuasAr6a_citrine
UseCre/Lox and LentiviralTagscitrineExpressionMammalianPromoterhSynAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-NEUROG3-T2A-PuroR
Plasmid#162341PurposeLentiviral expression of NEUROG3 under the control of the TetON promoterDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins6
Plasmid#195043PurposepFA6a derived selection cassette 5' flanked with tDEG1 transcription terminator, allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast SHMT2 CD
Plasmid#106302PurposeExpresses SHMT2 K280A catalytic site mutantDepositorInsertserine hydroxymethyltransferase 2 (SHMT2 Human)
UseRetroviralExpressionMammalianMutationK280A catalytic site mutation, Silent mutations d…Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_atp1_1397CN
Plasmid#186203PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted C of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1397C of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1397N of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(A)
Plasmid#85570PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetpA-hNEUROG2-iRPT
Plasmid#140764PurposeExpresses iRFP713, PuroR and rtTAM2 in mammalian cells, with TRE-hNEUROG2DepositorInsertsExpressionMammalianAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_GFP_Luciferase
Plasmid#155079PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only