We narrowed to 7,002 results for: tac
-
Plasmid#190194PurposePlasmid for the protein expression of 6xHis-TEV-NDP52 in a bacterial expression system. Internal reference: SMC401DepositorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pET15b MOSPD2 RD/LD [282-490]
Plasmid#186470PurposeExpression of human MOSPD2 (MSP domain from residue 282 to 490; mutant R404D/L406D, unable to bind FFAT motifs), fused to a 6HIS tag, in bacteriaDepositorInsertMOSPD2 motile sperm domain containing 2 (MOSPD2 Human)
Tags6HISExpressionBacterialMutationMSP domain [282-490]Available SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D
Plasmid#115193PurposeLentiviral transduction and expression of PDHA2S291D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S293D
Plasmid#115194PurposeLentiviral transduction and expression of PDHA2S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D/S293D
Plasmid#115195PurposeLentiviral transduction and expression of PDHA2S291D/S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_218
Plasmid#180533PurposeEntry vector containing K.rhaeticus native promoter pTtaC (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pTtaC (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 S111F-msfGFP
Plasmid#180340Purposemammalian expression of human SEPT9_i1 S111F fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 S111FPromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 R106W-msfGFP
Plasmid#180339Purposemammalian expression of human SEPT9_i1 R106W fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 R106WPromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 NCmut1-msfGFP
Plasmid#180329Purposemammalian expression of human SEPT9_i1 NCmut1 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 R289A R290A K291A K294APromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 D10-25-msfGFP
Plasmid#180334Purposemammalian expression of human SEPT9_i1 D10-25 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 D10-25PromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 DN7-msfGFP
Plasmid#180335Purposemammalian expression of human SEPT9_i1 DN7 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 DN7PromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 Gmut-msfGFP
Plasmid#180331Purposemammalian expression of human SEPT9_i1 Gmut fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 W520A, H530DPromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 NCmut2-msfGFP
Plasmid#180330Purposemammalian expression of human SEPT9_i1 NCmut2 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 I281D, M288DPromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
FMR1-E17B-P2A-NLuc
Plasmid#157857Purposedonor plasmid for FMR1-NlucDepositorAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_1
Plasmid#155069PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_2
Plasmid#155070PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_4
Plasmid#155068PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 ATG3 WT
Plasmid#129292PurposeGateway entry clone encoding wild-type human ATG3 with a stop codonDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseGateway entry vector / entry cloneAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 ATG3 K243R
Plasmid#129294PurposeGateway entry clone encoding human ATG3 K243RDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseGateway entry vector / entry cloneMutationchanged Lysine 243 to ArginineAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only