We narrowed to 3,890 results for: 28
-
Plasmid#239769PurposeExpresses independantly TTX-resistant (Y371C) variant of mouse Nav1.6 with a TAG codon at position 1425 and eGFP in mammalian cells.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pmNeon Green-N1-ARF3-R
Plasmid#202431PurposeMammalian expression vector containing pmNeonGreen-tagged ARF3DepositorAvailable SinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TNT4-TadA8e-SpRY N aa2-713-InteinN
Plasmid#209786PurposeExpresses TadA8e and SpRY cas9N by the specific TNT4 promoterDepositorInsertTNT4, TadA8e, SpRY N, inteinN
UseAAVPromoterTNT4Available SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-His10-Smt3-DDX5ΔPrD(kf)-SNAP
Plasmid#166150PurposeExpression of N. furzeri DDX5ΔPrD(1-535) mutant in E. coliDepositorInsertDDX5ΔPrD(1-535)
TagsHis10-Smt3 and SNAPExpressionBacterialMutationΔPrD(1-535)PromoterT7Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-His10-Smt3-DDX5ΔIDR(kf)-SNAP
Plasmid#166151PurposeExpression of N. furzeri DDX5ΔIDR(1-483) mutant in E. coliDepositorInsertDDX5ΔIDR(1-483)
TagsHis10-Smt3 and SNAPExpressionBacterialMutationΔIDR(1-483)PromoterT7Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP/CALR ins5 YD/FL-FLAG
Plasmid#214706PurposeMammalian expression of human CALR ins5 YD/FL-FLAGDepositorAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Hb9-CD14
Plasmid#204344PurposeKnock-in vector to insert a motor neuron-specific MACS-sortable genetic reporter into the AAVS1 locus in human pluripotent stem cells. Allows isolation of human iPSC-derived motor neurons.DepositorAvailable SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCav1 in pT3TS-Dest
Plasmid#194293PurposeIn vitro transcription of mKate2 tagged zebrafish caveolin1 from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone KZWDepositorInsertcaveolin (cav1.S Frog)
UseIn vitro transcription of mrnaAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCavin1a in pT3TS-Dest
Plasmid#194294PurposeIn vitro transcription of mKate2 tagged zebrafish cavin1a from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone LAIDepositorInsertcavin1a (cavin1a Zebrafish)
UseIn vitro transcription of mrnaAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3E-HsNRF2 (NFE2L2)
Plasmid#194302PurposeMultisite gateway entry clone for expression of human NRF2 (NFE2L2) with fusion tag at the N-terminus. Parton lab clone KRSDepositorInsertNFE2L2 (NFE2L2 Human)
UseMultisite gateway entry vectorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3E-DrCavin1a
Plasmid#194291PurposeMultisite gateway entry clone for expression of codon optimised zebrafish cavin1a with fusion tag at the N-terminus. Parton lab clone KXMDepositorInsertcavin1a (cavin1a Zebrafish)
UseMultisite gateway entry vectorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free ClLIS1 (M)
Plasmid#182484PurposeYeast integrative plasmid for expressing ERG20(F96W-N127W) (GAL10 promoter) and limonene synthase from Citrus limon (ClLIS1; GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsFPPS(M)
LS
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free deadFPPS-NES
Plasmid#182492PurposeYeast integrative plasmid for expressing ERG20 (GAL10 promoter) and fusion protein deadFPPS-AcNES1 (GAL7 promoter). deadFPPS is ERG20(K197G-K254A), an inactive mutant of ERG20.DepositorInsertsFPPS
deadFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dMET
Plasmid#176031PurposeA knock-out vector for dog METDepositorInsertA gRNA targeting the dog MET gene and the cDNA of Cas9 (MET )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gucy1b2-IRES-nlsCre-IRES-taulacZ-FNF TV
Plasmid#105196Purposetargeting vector to generate a Gucy1b2-IRES-nlsCre-IRES-taulacZ mouse strain.DepositorInsertGucy1b2-IRES-nlsCre-IRES-taulacZ-FNF (Gucy1b2 Mouse)
UseMouse TargetingAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-His6-K2P4.1A-mCherry-StreptagII
Plasmid#158743PurposeExpresses K2P4.1 isoform A with TEV protease cleavable N- and C-terminal affinity tags.DepositorInsertK2P4.1-A (KCNK4 Human)
TagsHis6 and mCherry with Streptag IIExpressionYeastMutationResidues 1-264 with N-linked glycosylation sites …PromoterAOX1Available SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-His6-K2P4.1B-mCherry-StreptagII
Plasmid#158744PurposeExpresses K2P4.1 isoform B with TEV protease cleavable N- and C-terminal affinity tags.DepositorInsertK2P4.1-B (KCNK4 Human)
TagsHis6 and mCherry with Streptag IIExpressionYeastMutationResidues 1-290 and N-linked glycosylation sites r…PromoterAOX1Available SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
CIB1 gRNA (BRDN0001147177)
Plasmid#76949Purpose3rd generation lentiviral gRNA plasmid targeting human CIB1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CIB1 gRNA (BRDN0001147329)
Plasmid#76950Purpose3rd generation lentiviral gRNA plasmid targeting human CIB1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only