We narrowed to 20,461 results for: ATO
-
Plasmid#49825Purposefor transcribing SRA nucl 767-999 of NM_001035235 with T7DepositorInsertsteroid receptor RNA activator RNA coding (SRA1 Human)
ExpressionBacterialMutationKpnI site at 5' start of RNA coding seqPromoterT7Available SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
SRAcode_in_pUC57_v3(419-771)
Plasmid#49823Purposefor transcribing SRA nucl 419-771 of NM_001035235 with T7DepositorInsertsteroid receptor RNA activator RNA coding (SRA1 Human)
ExpressionBacterialMutationKpnI site at 5' start of RNA coding seqPromoterT7Available SinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7
Plasmid#136466PurposeMammalian expression of non-targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
ExpressionMammalianPromoterCMV, SP6Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mito-PyronicSF/pCMV-myc-mito
Plasmid#124813PurposeHighly resposive GFP-based pyruvate nanosensor to explore mitochondrial metabolism.DepositorInsertPyronicSF
TagsMitochondrial Sequence SignalExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-ASAP5-WPRE
Plasmid#225709PurposePan-neuronal, pan-membrane expression of the genetically encoded voltage indicator ASAP5; can be used for dendritic voltage imagingDepositorInsertASAP5
UseAAVPromoterhuman synapsinAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMV-mito-R-GECO1
Plasmid#46021PurposeRed intensiometric genetically encoded Ca2+-indicators for optical imagingDepositorInsertR-GECO1
Tagsa duplex of the mitochondrial targeting signal of…ExpressionMammalianMutationSubstitutions relative to the mApple-derived anal…PromoterCMVAvailable SinceJuly 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-ASAP5-Kv2.1-WPRE
Plasmid#225707PurposePan-neuronal soma-targeted expression of the genetically encoded voltage indicator ASAP5DepositorHas ServiceAAV1InsertASAP5-Kv2.1
UseAAVPromoterhuman synapsinAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKI_ΩBBMVP16&WUS
Plasmid#220348PurposeExpresses BBM-VP16 and WUS in plant cellsDepositorTagsVP16 transcriptional activation domainExpressionPlantPromoterCaMV 35S and RPS5AAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
p27-mVenus reporter (PB)
Plasmid#190731PurposeThe p27 reporter vector, which expresses mVenus-fused, mutant (K–) p27 protein with a defective CDK binding.DepositorInsertsmVenus
p27
ExpressionBacterial and MammalianMutationp27-F62A-F64APromoterEF1αAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Dio-ASAP5-Kv2.1-WPRE
Plasmid#225708PurposeCre dependent soma-targeted expression of the genetically encoded voltage indicator ASAP5DepositorHas ServiceAAV9InsertASAP5-Kv2.1
UseAAVPromoterEF1αAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQE80L-SpyCatcher-ELP-GFP
Plasmid#69835PurposeBacterial expression plasmid containing SpyCatcher-ELP-GFP fusion. SpyCatcher forms a covalent bond with SpyTag and can be used to label plasma membrane localized SpyTag-C1C2 in live cells.DepositorInsertSpyCatcher-ELP-GFP
Tags6x His Tag, GFP, and TEV TagExpressionBacterialPromoterT5 promoter/lac operator elementAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-N-Myc-SCAP
Plasmid#134285PurposeExpresses Myc-tagged SCAP in mammalian cellsDepositorAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLifeAct-HyPer7
Plasmid#136464PurposeMammalian expression of F-actin targeted ultrasensitive hydrogen peroxide indicator HyPer7 fused with LifeAct peptide for optical imagingDepositorInsertHyPer7
TagsLifeActExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 DOX off blast NFS1
Plasmid#160801PurposeExpress Dox repressible NFS1DepositorInsertNFS1 (NFS1 Human)
UseLentiviralAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-H2BmGreenLantern
Plasmid#177332PurposeTo express a bright monomeric green FP to label eucaryotic cell nuclei. To be used in clearing and other fluorescent microscope methods.DepositorInsertH2B (Hist1h2bq Rat)
UseAAVTagsmGreenLanternExpressionMammalianMutationThis fusion protein was optimized to the Human co…PromoterCAGAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQE30-HyPer7
Plasmid#141071PurposeBacterial expression of ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsHisx6ExpressionBacterialPromoterT5Available SinceMarch 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFP-TTP
Plasmid#141190PurposeExpresses GFP-TTP in mammalian cells, can be used to make inducible cell lineDepositorAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLJM1 flag-cFLIP
Plasmid#211529PurposeExpresses flag-tagged cFLIP (CFLAR)DepositorAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc-C Med12His
Plasmid#49240Purposeexpresses human Med12 with His tag in insect cellsDepositorAvailable SinceNov. 6, 2013AvailabilityAcademic Institutions and Nonprofits only