We narrowed to 4,082 results for: Gaa
-
Plasmid#75590Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
ETNK1 gRNA (BRDN0001148358)
Plasmid#75532Purpose3rd generation lentiviral gRNA plasmid targeting human ETNK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PCK2 gRNA (BRDN0001146925)
Plasmid#78083Purpose3rd generation lentiviral gRNA plasmid targeting human PCK2DepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
NADK gRNA (BRDN0001146533)
Plasmid#78071Purpose3rd generation lentiviral gRNA plasmid targeting human NADKDepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
FASTKD3 gRNA (BRDN0001146322)
Plasmid#78063Purpose3rd generation lentiviral gRNA plasmid targeting human FASTKD3DepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
PAPSS1 gRNA (BRDN0001147882)
Plasmid#77612Purpose3rd generation lentiviral gRNA plasmid targeting human PAPSS1DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
NRBP2 gRNA (BRDN0001147825)
Plasmid#76453Purpose3rd generation lentiviral gRNA plasmid targeting human NRBP2DepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
CHKA gRNA (BRDN0001145792)
Plasmid#76586Purpose3rd generation lentiviral gRNA plasmid targeting human CHKADepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_CDC7_sg3
Plasmid#254535PurposeCDC7 knockoutDepositorAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiGuideFUT3-neo
Plasmid#250304PurposeEncodes gRNA targeting FUT3DepositorAvailable SinceMarch 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR V2 sgTMEM173_2
Plasmid#241457PurposeDelete TMEM173 (STING)DepositorAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
NSE-huCof K22Q + rat cof shRNA
Plasmid#245962PurposeSilencing of endogenous cofilin in rat/mouse neurons with replacment by neuronal specific expression of K22Q mutant of human cofilinDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutationK22QPromoterNSE for cofilin K22Q and pol III for shRNAAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ33-lenti-U6-Oct4-PE-acti-gRNA-DsRed
Plasmid#131076PurposeActivation of Mafa via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_SKIV2L2 (pAVA3251)
Plasmid#239323PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting SKIV2L2DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting SKIV2L2 (MTREX Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_ZCRB1 (pAVA3300)
Plasmid#239325PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNA stargeting ZCRB1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting ZCRB1 (ZCRB1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPKR_2g)-PGKpuro2AmCherry-W
Plasmid#208435PurposeLentiviral gRNA plasmid targeting human PKR gene, co-expression of mCherry tagDepositorInsertPKR (EIF2AK2 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U9Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMTOR_1k)-PGKpuro2ABFP-W
Plasmid#208429PurposeLentiviral gRNA plasmid targeting human MTOR gene, co-expression of BFP tagDepositorInsertMTOR (MTOR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMTOR_2b)-PGKpuro2ABFP-W
Plasmid#208430PurposeLentiviral gRNA plasmid targeting human MTOR gene, co-expression of BFP tagDepositorInsertMTOR (MTOR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only