We narrowed to 20,461 results for: ATO
-
Plasmid#172473PurposePiggybac vector for mammalian expression of TomKat (tdTomato-tdKatushka) FRET sensor for Cdc42 activity anchored to the membrane with the polybasic and CAAX motif from Kras.DepositorInserttdKatushka2-PBD(Pak1)-EVlinker-Cdc42-tdTomato-CAAX
UsePiggybac transposonTagspolybasic and CAAX motif from Kras, tdKatushka2, …ExpressionMammalianPromoterCAGAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ai27
Plasmid#34630PurposeCre-dependent expression of hChR2(H134R)-tdTomato, for optogenetic excitationDepositorInsertFloxed hChR2(H134R)-tdTomato
UseMouse TargetingTagstdTomatoMutationHis 134 has been mutated to ArgPromoterCAGAvailable SinceFeb. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
HT111_Fsyn_FAS(Cre off)_QuasAr6a_Citrine
Plasmid#178824PurposeNeuronal expression (Cre-off) of an archaerhodopsin-derived genetically encoded voltage indicator QuasAr6b carrying a Citrine expression tagDepositorInsertQuasAr6a_citrine
UseCre/Lox and LentiviralTagscitrineExpressionMammalianPromoterhSynAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-NEUROG3-T2A-PuroR
Plasmid#162341PurposeLentiviral expression of NEUROG3 under the control of the TetON promoterDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins6
Plasmid#195043PurposepFA6a derived selection cassette 5' flanked with tDEG1 transcription terminator, allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast SHMT2 CD
Plasmid#106302PurposeExpresses SHMT2 K280A catalytic site mutantDepositorInsertserine hydroxymethyltransferase 2 (SHMT2 Human)
UseRetroviralExpressionMammalianMutationK280A catalytic site mutation, Silent mutations d…Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(A)
Plasmid#85570PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_atp1_1397CN
Plasmid#186203PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted C of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1397C of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1397N of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetpA-hNEUROG2-iRPT
Plasmid#140764PurposeExpresses iRFP713, PuroR and rtTAM2 in mammalian cells, with TRE-hNEUROG2DepositorInsertsExpressionMammalianAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_GFP_Luciferase
Plasmid#155079PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(B)
Plasmid#85571PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti_mpx_AsCas12a(dual-gRNA)_h7SK(PacI-ClaI)_U6(I-SceI-NheI)_PGK-puro
Plasmid#189635PurposeLentiviral expression of double dual-AsCas12a gRNAs for generating combinatorial AsCas12a 3Cs librariesDepositorInserth7SK arrayed Cas12a gRNA cassette, hU6 arrayed Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_1
Plasmid#155059PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-puro shPOLE1_1
Plasmid#160810PurposeExpress Dox repressible shPOLE1DepositorInsertshPOLE1_1
UseLentiviralAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_1
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_3
Plasmid#155083PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_3
Plasmid#155075PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only