We narrowed to 4,276 results for: 424
-
Plasmid#114604PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & A60C cysteine mutations and a 42 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
UseTagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, A…PromoterAvailable sinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt18-90(Q18C)-22Q-P90C
Plasmid#114603PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & P90C cysteine mutations and a 22 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
UseTagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, P…PromoterAvailable sinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_ORI_AGAP1
Plasmid#99300PurposeLuciferase validation vector with AGAP1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr2: 236735694-236737193 (AGAP1 Human)
UseLuciferase; Starr-seq luciferase validation vectorTagsExpressionMammalianMutationPromoterAvailable sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_mP_AGAP1
Plasmid#99301PurposeLuciferase validation vector with AGAP1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr2: 236735694-236737193 (AGAP1 Human)
UseLuciferase; Starr-seq luciferase validation vectorTagsExpressionMammalianMutationPromoterAvailable sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_SCP1_AGAP1
Plasmid#99302PurposeLuciferase validation vector with AGAP1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr2: 236735694-236737193 (AGAP1 Human)
UseLuciferase; Starr-seq luciferase validation vectorTagsExpressionMammalianMutationPromoterAvailable sinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NRAS_p.Y64D
Plasmid#81666PurposeGateway Donor vector containing NRAS, part of the Target Accelerator Plasmid Collection.DepositorInsertNRAS (NRAS Human)
UseGateway entry vectorTagsExpressionMutationY64DPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_ELF1_p.P32S
Plasmid#81486PurposeGateway Donor vector containing ELF1 , part of the Target Accelerator Plasmid Collection.DepositorInsertELF1 (ELF1 Human)
UseGateway entry vectorTagsExpressionMutationP32SPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_C15orf23_p.P26S
Plasmid#81368PurposeGateway Donor vector containing C15ORF23 , part of the Target Accelerator Plasmid Collection.DepositorInsertC15ORF23 (KNSTRN Human)
UseGateway entry vectorTagsExpressionMutationP26S; A40E; R75L; P92S; S232GPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_C15orf23_p.P26L
Plasmid#81372PurposeGateway Donor vector containing C15ORF23 , part of the Target Accelerator Plasmid Collection.DepositorInsertC15ORF23 (KNSTRN Human)
UseGateway entry vectorTagsExpressionMutationP26L; A40E; R75L; P92S; S232GPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
CALM1 gRNA (BRDN0001145447)
Plasmid#75761Purpose3rd generation lentiviral gRNA plasmid targeting human CALM1DepositorInsertCALM1 (CALM1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CALM1 gRNA (BRDN0001145487)
Plasmid#75762Purpose3rd generation lentiviral gRNA plasmid targeting human CALM1DepositorInsertCALM1 (CALM1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CALM1 gRNA (BRDN0001146464)
Plasmid#75763Purpose3rd generation lentiviral gRNA plasmid targeting human CALM1DepositorInsertCALM1 (CALM1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CALM1 gRNA (BRDN0001148506)
Plasmid#75764Purpose3rd generation lentiviral gRNA plasmid targeting human CALM1DepositorInsertCALM1 (CALM1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM4D(Gi)-mCherry (AAV Retrograde)
Viral Prep#44362-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-DIO-hM4D(Gi)-mCherry (#44362). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM4D(Gi)-mCherry plasmid DNA. Syn-driven, Cre-dependent, hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available sinceJune 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry (AAV Retrograde)
Viral Prep#44361-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA. Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available sinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM4D(Gi)-mCherry (AAV PHP.eB)
Viral Prep#44362-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-hSyn-DIO-hM4D(Gi)-mCherry (#44362). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM4D(Gi)-mCherry plasmid DNA. Syn-driven, Cre-dependent, hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV were produced with the PHP.eB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available sinceMarch 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry (AAV PHP.eB)
Viral Prep#44361-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA. Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV were produced with the PHP.eB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available sinceMarch 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_FUS_FLI1
Plasmid#205822PurposeExpress mEGFP-tagged fusion protein, FUS_FLI1 from patient-derived sequenceDepositorUseTagsmEGFPExpressionMammalianMutationPromoterAvailable sinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ACVR1C
Plasmid#23615DepositorInsertACVR1C (ACVR1C Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only