We narrowed to 27,863 results for: CAT
-
Plasmid#207631PurposeA plasmid encoding photocaged SpyCatcher (pSC) fused to C-terminal UnaG fragment.DepositorInsertphotocaged SpyCatcher-cUnaG
Tags6xHisExpressionBacterialMutationAmber stop codon at SC's critical lysinePromoterT7Available SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC-LPETG
Plasmid#207629PurposeA plasmid encoding photocaged SpyCatcher (pSC) with a C-terminal Sortase recognition sequence.DepositorInsertphotocaged SpyCatcher-LPETG
Tags6xHisExpressionBacterialMutationAmber stop codon at SC's critical lysinePromoterT7Available SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHWBF09exp
Plasmid#130833PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertMLKP1
TagseGFP-FLAG-HAExpressionPlantPromoterCaMV 35SAvailable SinceSept. 28, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
MLKP2del4
Plasmid#130837PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertMLKP2
TagseGFP-FLAG-HAExpressionPlantMutationDeletion of terminal four amino acid residuesPromoterCaMV 35SAvailable SinceSept. 28, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
MLKP1delTM
Plasmid#130841PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertMLKP1
TagseGFP-FLAG-HAExpressionPlantMutationDeletion of transmembrane domainPromoterCaMV 35SAvailable SinceSept. 28, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
MLKG1delKASH
Plasmid#130842PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertMLKG1
TagseGFP-FLAG-HAExpressionPlantMutationDeletion of KASH domainPromoterCaMV 35SAvailable SinceSept. 28, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
MLKP2del4ec
Plasmid#130843PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertMLKP2
UseUnspecifiedTagseGFP-FLAG-HAMutationDeletion of terminal four amino acid residuesAvailable SinceSept. 28, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
MLKP1del4ec
Plasmid#130844PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertMLKP1
UseGateway entry vectorTagseGFP-FLAG-HAMutationDeletion of terminal four amino acid residuesAvailable SinceSept. 28, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
MLKP1delKASHec
Plasmid#130845PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertMLKP1
UseGateway entry vectorTagseGFP-FLAG-HAMutationDeletion of KASH domain, addition of three alanin…Available SinceSept. 28, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
MLKG1delKASHec
Plasmid#130846PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertMLKG1
UseGateway entry vectorTagseGFP-FLAG-HAMutationDeletion of KASH domainAvailable SinceSept. 28, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHWBF07EC
Plasmid#130828PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertMLKP2
UseGateway entry vectorTagseGFP-FLAG-HAAvailable SinceSept. 28, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHWBF09EC
Plasmid#130829PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertMLKP1
UseGateway entry vectorTagseGFP-FLAG-HAAvailable SinceSept. 28, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
ECPK1D
Plasmid#130830PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertMLKG1
UseGateway entry vectorTagseGFP-FLAG-HAAvailable SinceSept. 28, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHWBF07exp
Plasmid#130832PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertMLKP2
TagseGFP-FLAG-HAExpressionPlantPromoterCaMV 35SAvailable SinceSept. 28, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_DE-Venus
Plasmid#202157PurposeLevel 0 plasmid containing a Venus fluorescent protein with DE overhangs used to build a level 1 construct.DepositorInsertVenus gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_DE-sfGFP
Plasmid#202156PurposeLevel 0 plasmid containing a sfGFP fluorescent protein with DE overhangs used to build a level 1 construct.DepositorInsertsfGFP gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_DE_mTurquoise2
Plasmid#202155PurposeLevel 0 plasmid containing a mTurquoise2 fluorescent protein with DE overhangs used to build a level 1 construct.DepositorInsertmTurquoise2 gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_DE-RFP1
Plasmid#202154PurposeLevel 0 plasmid containing a RFP1 fluorescent protein with DE overhangs used to build a level 1 construct.DepositorInsertRFP1 gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_DE-mRuby3
Plasmid#202153PurposeLevel 0 plasmid containing a mRuby3 fluorescent protein with DE overhangs used to build a level 1 construct.DepositorInsertmRuby3 gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_DE-3xStop
Plasmid#202151PurposeLevel 0 plasmid containing 3 consecutive stop codons with DE overhangs used to build a level 1 constuct.DepositorInsert3x Stop codon
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_CD-eGFP
Plasmid#202149PurposeLevel 0 plasmid containing an eGFP fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInserteGFP gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-Venus
Plasmid#202148PurposeLevel 0 plasmid containing a Venus fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInsertVenus gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_CD-sfGFP
Plasmid#202147PurposeLevel 0 plasmid containing a sfGFP fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInsertsfGFP gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-mTurquoise2
Plasmid#202146PurposeLevel 0 plasmid containing a mTurquoise2 fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInsertmTurquoise2 gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_CD-mRFP1
Plasmid#202145PurposeLevel 0 plasmid containing a mRFP1 fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInsertmRFP1 gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-eYGFP-uv
Plasmid#202144PurposeLevel 0 plasmid containing an eYGFP-uv fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInserteYGFP-uv gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-mcherry
Plasmid#202143PurposeLevel 0 plasmid containing a mCherry fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInsertmCherry gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-eCFP
Plasmid#202142PurposeLevel 0 plasmid containing an eCFP fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInserteCFP gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-roGFP
Plasmid#202140PurposeLevel 0 plasmid containing a roGFP fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInsertroGFP gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-eYFP
Plasmid#202139PurposeLevel 0 plasmid containing an eYFP fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInserteYFP gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_AF-spacer
Plasmid#202130PurposeLevel 0 plasmid containing a small non-coding spacer sequence with AF overhangs used to build level 1 constructs.DepositorInsertSpacer
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
FKBP-TalinRod-mEmerald
Plasmid#202382PurposeFKBP12-Talin(434-2541)-mEmeraldDepositorInsertFKBP12-Talin(434-2541)-mEmerald
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
FKBP-TalinC11-mEmerald
Plasmid#202381PurposeFKBP12-Talin(1974-2541)-mEmeraldDepositorInsertFKBP12-Talin(1974-2541)-mEmerald
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
mApple-TalinN12-FB(wt)
Plasmid#202385PurposemApple-Talin(1-2299)-FRBDepositorInsertmApple-Talin(1-2299)-FRB
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
mApple-TalinN3-FRB(wt)
Plasmid#202384PurposemApple-Talin(1-911)-FRBDepositorInsertmApple-Talin(1-911)-FRB
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
mApple-TalinN10-FRB
Plasmid#202380PurposemApple-Talin(1-1973)-FRBDepositorInsertmApple-Talin(1-1973)-FRB
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHiUGE Myc-epitope donor ORF2
Plasmid#200376PurposeTagging endogenously expressed proteins with Myc epitope, C-terminalDepositorInsertMyc epitope
ExpressionMammalianMutationNAAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
H5_fold-0_Elsa
Plasmid#201825PurposeExpresses H5_fold-0_Elsa in bacterial cellsDepositorInsertH5_fold-0_Elsa
Tags6xHis, TEV cleavage siteExpressionBacterialAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG306-pTet07-synYFP[TTG/AGA]-4xArg[CGA]-nLuc
Plasmid#199759PurposeElongation reporter construct to quantify elongation duration of 4_CGA stallingDepositorInsertsynYFP[TTG/AGA]-4xArg[CGA]-nLuc
ExpressionYeastPromoterTetO7Available SinceMay 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1067L
Plasmid#200253PurposepBac-U6-gRNA(doublesex+Intersex+bTublin)-3xp3-tdTomatoDepositorInsert6 gRNAs targeting Doublesex, Intersex, bTublin
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG306-pTet07-synYFP[TTG/AGA]-6xArg[CGA]-nLuc
Plasmid#199760PurposeElongation reporter construct to quantify elongation duration of 6_CGA stallingDepositorInsertsynYFP[TTG/AGA]-6xArg[CGA]-nLuc
ExpressionYeastPromoterTetO7Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG306-pTet07-synYFP[TTG/AGA]-6xArg[AGA]-nLuc
Plasmid#199761PurposeElongation reporter construct to quantify elongation duration of 6_AGA stallingDepositorInsertsynYFP[TTG/AGA]-6xArg[AGA]-cLuc
ExpressionYeastPromoterTetO7Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
SP_H6_Halo_L172Q_KDEL_pBABEpu
Plasmid#183690PurposeRetroviral expression of ER-targeted metastable Halotag/folding sensor (ER HaloL172Q)DepositorInsertER Halo(L172Q)
UseRetroviralMutationL72Q in HalotagAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
SP_H6_Halo_M21K_F86L_KDEL_pBABEpu
Plasmid#183691PurposeRetroviral expression of ER-targeted metastable Halotag/folding sensor (ER HaloM21K_F86L)DepositorInsertER Halo(M21K_F86L)
UseRetroviralMutationM21K_F86L in HalotagAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET30_Halotag_K73T_Jdomain
Plasmid#183693PurposeBacterial expression of ER-targeted metastable Halotag/folding sensor (HaloK73T) fused with J domainDepositorInsertER Halo(K73T)-J domain
ExpressionBacterialMutationK73T in HalotagAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
-
pEYFP-N1-HsSmg6-mut-siRNAres_I
Plasmid#146588PurposeMammalian Expression of HsSmg6-mut-siRNAresDepositorInsertHsSmg6-mut-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORE303N_CEN12Fuzzy3MYB
Plasmid#194440PurposeCRISPR, Cas9 driven by double 35S, nptII for plant selection, knockout: CEN12 and Fuzzy3MYBDepositorInsertgRNA array targeting CEN1, Fuzzy3MYB
UseCRISPRExpressionPlantPromoterMtU6Available SinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only