We narrowed to 73,711 results for: INA
-
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUMO His6 SUMO SnRK2.3 (19-361)
Plasmid#177846PurposeBacterial Expression of SnRK2.3DepositorAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral N
Plasmid#113009PurposeFor bacterial expression of MBP fusion of N terminal region of Drosophila TralDepositorAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral C
Plasmid#113008PurposeFor bacterial expression of MBP fusion of C terminal region of Drosophila TralDepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral C 15A
Plasmid#113007PurposeFor bacterial expression of MBP fusion of C terminal region of Drosophila Tral phosphomutant (15A)DepositorInsertC terminus of tral (tral Fly)
ExpressionBacterialMutationPNG phosphorylation sites mutated to AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
3336 pcDNA3 Bcl-2
Plasmid#8768DepositorInsertBcl-2 (BCL2 Human)
ExpressionMammalianAvailable SinceNov. 14, 2005AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_RPS10
Plasmid#127129DepositorAvailable SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
hGFAP-NLS-HA-Dre-P2A-BFP
Plasmid#51277PurposeCo-expression of the site-specific recombinase Dre and BFP under the control of the hGFAP promoterDepositorInsertNLS-HA-Dre-P2A-BFP
ExpressionMammalianPromoterhGFAPAvailable SinceMarch 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_RPS10_K138/139R
Plasmid#127138DepositorAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pJ151-HDR
Plasmid#113631PurposeContains two recombination homology arms and loxP-flanked cassette encoding puromycin resistance gene, Venus fluorescence marker, thymidine kinase suicide gene, for scarless chromosomal engineering.DepositorInsertsLeft homology arm
Puromycin resistance gene
Venus fluorescence gene
Thymidine kinase
Right homology arm
UseCre/Lox; Homology recombination selection vectorExpressionBacterial and MammalianPromoterEF1a promoter, EF1a promoter (T2A cleaving sequen…Available SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
3349 pSFFV-neo Bcl-2
Plasmid#8769DepositorInsertBcl-2 (BCL2 Human)
ExpressionMammalianAvailable SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
-
pNK6032
Plasmid#219738PurposeMoClo-compatible Level 0 - promoter + 5U vector carrying promoter FMVDepositorInsertFigwort mosaic virus (FMV) promoter
UseSynthetic BiologyExpressionPlantPromoterFMVAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pET28b::mAID
Plasmid#15923DepositorAvailable SinceNov. 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TRIM25_G1
Plasmid#127119DepositorInsertgRNA TRIM25 (TRIM25 Human)
UseCRISPRAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEBG-TRAF2 (GST)
Plasmid#21586DepositorAvailable SinceNov. 24, 2009AvailabilityAcademic Institutions and Nonprofits only -
pNK869
Plasmid#219737PurposeMoClo-compatible Level 0 - promoter + 5U vector carrying promoter AtPD7DepositorInsertpromoter of serine carboxypeptidase-like gene AtSCPL30, AtPD7
UseSynthetic BiologyExpressionPlantPromoterAtPD7Available SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_ZNF598
Plasmid#127121DepositorInsertgRNA ZNF598 (ZNF598 Human)
UseCRISPRAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only