We narrowed to 4,666 results for: Gca
-
Plasmid#76942Purpose3rd generation lentiviral gRNA plasmid targeting human NEK8DepositorAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pMIR-31-192-193a-Reporter
Plasmid#71874PurposeMammalian expression vector for the analysis of miR-31-19α-193a activityDepositorInsertBinding sequence targeted by miR-31, miR192, and miR-193a-5p
Tagsfirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.1_puro_shJUND #2
Plasmid#136583PurposeExpresses an inducible short hairpin targeting human JUND sequenceDepositorAvailabilityAcademic Institutions and Nonprofits only -
pCMV-GenEPi
Plasmid#140236PurposeMammalian expression of Piezo1-based fluorescent force sensor GenEPiDepositorInsertGenEPi (Piezo1-based fluorescent force sensor) (PIEZO1 Human)
TagsGCaMP 6s RS1 EF4ExpressionMammalianPromotersimian CMV IE94Available SinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR2
Plasmid#167001PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDK2 gRNA (BRDN0001148866)
Plasmid#77191Purpose3rd generation lentiviral gRNA plasmid targeting human CDK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgCTL
Plasmid#234771PurposeNon Targeting ControlDepositorInsertNon Targeting Control sgRNA
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 LIPT1-2
Plasmid#184481PurposeLentivirus gRNA targeting human LIPT1 geneDepositorInsertLIPT1 (LIPT1 Human)
UseLentiviralAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBoBi-hTRPV4-C-GC6s
Plasmid#154150PurposeTo detect the calcium ion releases from TRPV4 channelDepositorAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shSTING-Hsa
Plasmid#128158PurposeDoxycyclin inducible shRNA knockdown of human STING geneDepositorAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSLC7A11/xCT-1
Plasmid#161818Purposeknock out SLC7A11/xCT in mammalian cellsDepositorInsertSLC7A11 solute carrier family 7 member 11 xCT (SLC7A11 Human)
UseCRISPR and LentiviralAvailable SinceDec. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 1 tet pLKO puro
Plasmid#162985PurposeTet-inducible shRNA targeting human METTL3 #1DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 2 tet pLKO puro
Plasmid#162984PurposeTet-inducible shRNA targeting human METTL3 #2DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_pegRNA_(PP7-C4-Q1)
Plasmid#232433PurposepegRNA with optimized 3' modifications to correct the rd6 mutationDepositorInsert3'-PP7-tagged pegRNA for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_HEK3+1T>A_(PP7-C4-Q1)
Plasmid#232437PurposepegRNA with optimized 3' modifications to facilitate a +1 T to A prime edit in the HEK3 locusDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shRUNX1 puro
Plasmid#45816DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g3)-PGKpuroBFP-W
Plasmid#211984PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001149212)
Plasmid#77051Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSmarca4#1/Cre
Plasmid#173619PurposeExpresses a Smarca4-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Smarca4 (Smarca4 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only