We narrowed to 11,112 results for: nar;
-
Pooled Library#157971PurposeEncodes Spike ectodomain mutations that stabilize 'up' prefusion conformationDepositorExpressionBacterial and YeastSpeciesSars-cov-2Available sinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pEGFP-N1-FUS/TLS-FLAGC
Plasmid#60362PurposePlasmid for expression of FLAG-GFP tagged human FUS/TLS (C-terminal tag). Confers resistance to G418.DepositorInsertFUS (FUS Human)
UseTagsFLAG and GFPExpressionMammalianMutationPromoterCMVAvailable sinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
DNMT3A-dCas9
Plasmid#100090PurposeDNMT3A fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertDNMT3A (DNMT3A Human)
UseCRISPRTags3XFLag-NLS-DNMT3A-dCas9-NLSExpressionMammalianMutationincludes aa 602-912PromoterCMVAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
dCas9-EGFP
Plasmid#232761PurposeExpresses dCas9-EGFPDepositorInsertdCas9-EGFP
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HA-LMW-FGF2
Plasmid#157663PurposeExpresses FGF2 in mammalian cellDepositorInsertFibroblast growth factor 2 (FGF2 Human)
UseTagsHA tagExpressionMammalianMutationdeleted amino acid 1-134PromoterAvailable sinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP core
Plasmid#179543Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertS. Pyogenes dCas9 with c-terminal human CBP core (aa 1084-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP FL
Plasmid#179550Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human CBP driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human CBP (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-HA_WT POLH
Plasmid#201671PurposeExpression of WT DNA polymerase eta with an N-terminal HA tag in mammalian cellsDepositorInsertPolymerase eta (POLH Human)
UseTagsHAExpressionMammalianMutationCoding sequence has been optimised for expression…PromoterCMVAvailable sinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ezh2[FL]-dCas9
Plasmid#100086PurposeFull-length [FL] mouse Ezh2 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsert14056 (Ezh2 Mouse)
UseCRISPRTags3XFLag-NLS-Ezh2[FL]-dCas9-NLSExpressionMammalianMutationPromoterCMVAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pICE-RNaseHI-D10R-E48R-NLS-mCherry
Plasmid#60367PurposePlasmid for expression of an inactive mutant of bacterial RNase HI tagged with NLS-mCherry that can be used to detect R-loops. Confers resistance to Puromycin. Expression is inducible in T-REx cells.DepositorInsertRNase HI-D10R-E48R
UseTagsNLS from SV40 T antigen and mCherryExpressionMammalianMutationD10R+E48R; catalyticaly inactivePromoterCMV-tetAvailable sinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB-CuO-V5 CASC3 siRes1+2 f.l. WT
Plasmid#158540PurposeFor PiggyBac-mediated integration of V5-tagged siRNA-resistant full-length CASC3DepositorInsertCASC3; BTZ; MLN51 (CASC3 Human)
UseTagsV5ExpressionMammalianMutationPromoterCMVAvailable sinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9-GCN5 FL
Plasmid#179552Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human GCN5 driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human GCN5 (KAT2A Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet-1-NONO(53-312)
Plasmid#135442PurposeExpresses NONO 53-312 in the second site; for co-expression with His-tagged proteinDepositorInsertNon-POU domain-containing octamer-binding protein (NONO Human)
UseTagsExpressionBacterialMutationPromoterT7Available sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
G9A[SET]-dCas9
Plasmid#100089PurposeCatalytic domain [SET] of human G9A fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertG9A (EHMT2 Human)
UseCRISPRTags3XFLag-NLS-G9A[SET]-dCas9-NLSExpressionMammalianMutationG9A[SET] includes aa 829-1209PromoterCMVAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJet-CMV-IARS1-GFP
Plasmid#212322PurposeEGFP-tagged IARS1DepositorInsertIARS (IARS1 Human)
UseTagsEGFPExpressionMammalianMutationWildtypePromoterCMVAvailable sinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-cj-E sgRNA
Plasmid#169915PurposeExpression of sgRNA on an optimized gRNA scaffold contains A-U pair flip stabilize the CjCas9/sgRNA complex.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Linear Tau 0N4R 3X Flag tag
Plasmid#194171PurposeInsert contains linear tau 0N4R with a 3X Flag tag. Expresses linear protein tau 0N4R with a 3X Flag tag for Immunoprecipitation.DepositorInsertMicrotubule-Associated Protein Tau 0N4R
UseTags3X FlagExpressionMammalianMutationPromoterAvailable sinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJet-CMV-IARS1[W435C]-GFP
Plasmid#212323PurposeEGFP-tagged IARS1 Trp435CysDepositorInsertIARS (IARS1 Human)
UseTagsEGFPExpressionMammalianMutationTrp435cysPromoterCMVAvailable sinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pL452-Sf3b1-K700E
Plasmid#90425Purposeselectable HDR vector to introduce K700E mutation within mus Sf3b1 gene (for use with sgSf3b1(T1) and pL452(hygro)-Sf3b1-K700K plasmids enabling generation of hemizygous K700E mutation)DepositorInsertSf3b1 - left and right homology arms (Sf3b1 Mouse)
UseHomology-directed repair vectorTagsExpressionMutationPromoterAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only