We narrowed to 24,337 results for: Spr;
-
Plasmid#90645Purpose3rd generation lentiviral gRNA plasmid targeting human CTPS1DepositorInsertCTPS1 (Guide Designation E12.3)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
CTPS1 E11.3 gRNA
Plasmid#90644Purpose3rd generation lentiviral gRNA plasmid targeting human CTPS1DepositorInsertCTPS1 (Guide Designation E11.3)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
FBXO5 D4.4 gRNA
Plasmid#90687Purpose3rd generation lentiviral gRNA plasmid targeting human FBXO5DepositorInsertFBXO5 (Guide Designation D4.4)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
MAD2L1BP F1.1 gRNA
Plasmid#90744Purpose3rd generation lentiviral gRNA plasmid targeting human MAD2L1BPDepositorInsertMAD2L1BP (Guide Designation F1.1)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
MAD2L1BP F2.1 gRNA
Plasmid#90745Purpose3rd generation lentiviral gRNA plasmid targeting human MAD2L1BPDepositorInsertMAD2L1BP (Guide Designation F2.1)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
cBEST4
Plasmid#234660PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertionDepositorInsertsspCas9 cytosine base editor
Golden Gate compatible sgRNA insertion cassette
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterP3 and tcp830Available sinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Nat-ADE2
Plasmid#232106PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRTagsExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg-ADE2
Plasmid#232104PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRTagsExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg-ADE2
Plasmid#232107PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRTagsExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB9
Plasmid#210036PurposeContains Cas9 gRNA cloning site, inducible Cas9, UCOE, puro-T2A-eGFPDepositorInsertsCas9
puro-T2A-eGFP
UseCRISPRTagsSV40 NLS and nucleoplasmin NLSExpressionMammalianMutationPromoterEF-1α and TRE3GAvailable sinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-Apr
Plasmid#208000PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorUseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_dCas9-XTEN-KRAB-p2A-mCherry
Plasmid#222107PurposeDonor vector for CRISPRi integration at AAVS1 with an mCherry fluorophoreDepositorInsertCRISPRi-kox1(KRAB) (cas9 Human, S. pyogenes)
UseAAV and CRISPRTagsHA and P2A-mCherryExpressionMammalianMutationD10A, H840APromoterAvailable sinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_dCas9-XTEN-KRAB-p2A-GFP
Plasmid#222108PurposeDonor vector for CRISPRi integration at AAVS1 with a GFP fluorophoreDepositorInsertCRISPRi-kox1(KRAB) (cas9 Human, S. pyogenes)
UseAAV and CRISPRTagsHA and P2A-GFPExpressionMammalianMutationD10A, H840APromoterAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDM028
Plasmid#216809PurposeVector for Aspergillus CRISPR-Cas9 genetic engineering with Golden Gate cloning drop-out cassette for protospacer insertion and hph selectable marker.DepositorTypeEmpty backboneUseCRISPR; Fungal expressionTagsExpressionBacterialMutationPromoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only