We narrowed to 12,152 results for: CHL

#48653

Bacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol

George Church

Esvelt et al Nat Methods. 2013 Sep 29. doi: 10.1038/n

Oct. 17, 2013

Academic Institutions and Nonprofits only

#166403

Rab18 fused to APEX2 and a Flag tag in N-ter under control of a weak L30 promoter.

Raphael Gaudin

Bare et al bioRxiv 2025.10.07.680694

Feb. 2, 2026

Academic Institutions and Nonprofits only

#166404

Rab5C fused to APEX2 and a Flag tag in N-ter under control of a weak L30 promoter.

Raphael Gaudin

Bare et al bioRxiv 2025.10.07.680694

Feb. 2, 2026

Academic Institutions and Nonprofits only

#238470

pMOBC360_VL: Vector Left (VL) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approach

Christopher A. O'Callaghan

Flores-Fernandez et al Nucleic Acids Res. 2025 Jun 20;53(12):gk

July 24, 2025

Academic Institutions and Nonprofits only

#127394

Expresses amcyan fluorescent gene and sRNA nt 539-559

Ryan Senger

Tanniche et al Biotechnol Prog. 2023 May-Jun;39(3):e332

July 2, 2025

Academic Institutions and Nonprofits only

#238471

pMOBC360_VR: Vector Right (VR) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approach

Christopher A. O'Callaghan

Flores-Fernandez et al Nucleic Acids Res. 2025 Jun 20;53(12):gk

June 18, 2025

Academic Institutions and Nonprofits only

#226496

pMOBC360_VM: Vector Middle (VM) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approach

Christopher A. O'Callaghan

Flores-Fernandez et al Nucleic Acids Res. 2025 Jun 20;53(12):gk

June 10, 2025

Academic Institutions and Nonprofits only

#228472

Vector for the expression of MpPHOT fused to the N-terminal half of YFP in plants (for Agrobacterium-mediated genetic transformation.)

Yutaka Kodama

Ishikawa et al Plant J. 2022 Apr 27. doi: 10.1111/tpj.1

Dec. 13, 2024

Academic Institutions and Nonprofits only

#228475

Binary vector for the expression of MpRTN1 fused to the sGFP in plants (for Agrobacterium-mediated genetic transformation.)

Yutaka Kodama

Ishikawa et al Plant J. 2022 Apr 27. doi: 10.1111/tpj.1

Dec. 13, 2024

Academic Institutions and Nonprofits only

#228477

Vector for the expression of MpRTN1 fused to the N-terminal half of YFP in plants (for Agrobacterium-mediated genetic transformation.)

Yutaka Kodama

Ishikawa et al Plant J. 2022 Apr 27. doi: 10.1111/tpj.1

Dec. 13, 2024

Academic Institutions and Nonprofits only