We narrowed to 7,570 results for: Pol
-
Plasmid#167353PurposeddPCR gating control for droplets containing 5'pol or 3'pol targetsDepositorInsertpol
UseOtherAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ8001 - pCMV-R8.91 (D64V)
Plasmid#202687PurposeR8.91 plasmid with mutated integrase (D64V)DepositorInsertgag pol
UseLentiviralExpressionMammalianMutationD64VAvailable SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCiPS-NIFV
Plasmid#110807PurposeNon-Integrating Foamy Virus pol-expressing helper plasmid with mutations in the DDE catalyic core motif of the integrase sequence, remaining as unintegated episomes in transduced cellsDepositorInsertPol
ExpressionMammalianMutation2 mutations in the DDE catalyic core motif of the…PromoterCMVAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
Seattle_IPDA_control_29_006
Plasmid#167352PurposeddPCR gating control for droplets containing either env+5'pol targets OR env+3'pol targetsDepositorInsertpol_env
UseOtherAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEV53D
Plasmid#44168DepositorInsertEquine infectious anemia virus (EIAV) gag-pol,rev, and S2
UseLentiviralExpressionMammalianMutationA131T mutation in gag; Deletion of viral LTR sequ…PromoterCMVAvailable SinceApril 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
p8.9 NdeltaSB
Plasmid#132929PurposeMinimal HIV-1 packaging plasmid for gag and pol expressionDepositorInsertgag and pol
UseLentiviralAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDlg/pRRE-int-MS2M
Plasmid#166032PurposeExpression of bacteriophage-derived MS2 coat protein fused HIV-1 Lentiviral Gag-Pol at C terminal with a HIV-1 protease cleavage signal between MS2 and Gag-Pol.DepositorInsertGag-Pol-MS2
UseLentiviralMutationD64V mutation within the integrase within PolAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv
Plasmid#217437PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu.DepositorInsertgag/pol
UseLentiviralAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
Seattle_IPDA_control_6_002
Plasmid#167348PurposeddPCR gating control for droplets containing either gag+5'pol targets OR 3'pol+tat targetsDepositorInsertpol_gag_tat
UseOtherAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
multi-shRNA vector
Plasmid#12391DepositorAvailable SinceSept. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Pol-II WT
Plasmid#35175DepositorAvailable SinceMarch 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA Q67H/N74D
Plasmid#217441PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef. Contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q67H,N74D mutations in CA).DepositorInsertgag/pol
UseLentiviralMutationCA Q67H,N74DAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA E45A
Plasmid#217438PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with E45A mutation in CA).DepositorInsertgag/pol
UseLentiviralMutationCA E45AAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA Q63/67A
Plasmid#217439PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q63A,Q67A mutations in CA).DepositorInsertgag/pol
UseLentiviralMutationCA Q63A,Q67AAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA M66I
Plasmid#217440PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with M66I mutation in CA).DepositorInsertgag/pol
UseLentiviralMutationCA M66IAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
SIV_Gag_Pol
Plasmid#236243Purpose3rd generation SIV-based lentiviral packaging plasmid; Contains SIV Gag and PolDepositorInsertSIV Gag and Pol
UseLentiviralAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-T7pol
Plasmid#59926PurposeExpression vector for T7 RNA polymerase geneDepositorInsertT7 RNA polymerase
ExpressionMammalianPromoterCAGAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET11phiC31poly(A)
Plasmid#18942DepositorInsertphiC31 integrase (int Streptomyces phage phiC31)
ExpressionBacterialAvailable SinceAug. 13, 2008AvailabilityAcademic Institutions and Nonprofits only