We narrowed to 13,845 results for: Cas9
-
Plasmid#192685PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a, U6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_2
Plasmid#192686PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a, U6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_3
Plasmid#192687PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #3
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a, U6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti sgRNA NGFR CFP out of frame
Plasmid#155283PurposeLentiviral plasmid for sgRNA, NGFR marker, editing detected with CFP, used with 155280DepositorTypeEmpty backboneUseTagsExpressionMutationPromoterAvailable sinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLSB-KAN
Plasmid#166700PurposeCombined sgRNA/Cas9 pLSB vector with kanMX6 (G418) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
UseTagsExpressionYeastMutationPromoteradh15 promoter and tRNA Ser promoterAvailable sinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGES201
Plasmid#190197PurposeFor CRISPR-Cas9 mediated gene editing in soybean, soybean elongation factor 1A promoter (pM4)-Cas9, GmU6-sgRNA, Basta selectionDepositorInsertspCas9
UseCRISPRTags3xFlagExpressionPlantMutationplant-codon optimizedPromoterGlycine max elongation factor 1A(pM4)Available sinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLSB-HYG
Plasmid#166699PurposeCombined sgRNA/Cas9 pLSB vector with hphMX6 (hygromycin) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
UseTagsExpressionYeastMutationPromoteradh15 promoter and tRNA promoterAvailable sinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLSB-NAT
Plasmid#166698PurposeCombined sgRNA/Cas9 pLSB vector with natMX6 (cloNAT) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
UseTagsExpressionYeastMutationPromoteradh15 promoter and tRNA promoterAvailable sinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-CASANOVA
Plasmid#113035PurposeCASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno EA
Plasmid#64071PurposeAdenovirus for the expression of gRNAs targeting intron 19 of murine Alk and intron 14 of Eml4DepositorInsertU6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9
UseAdenoviralTagsFLAG-Cas9ExpressionMutationPromoterU6 and CBhAvailable sinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
SGyA
Plasmid#160292PurposeDrives expression of Cas9 and a TdTomato fluorescent markerDepositorInsertsVas promoter
hSpCas9
tdTomato
CTCF insulator
Gypsy insulator
Left homology arm Y chromosome
Right homology arm Y chromosome
UseTagsT2A GFPExpressionInsectMutationPromoterAvailable sinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFC902
Plasmid#106904PurposeThe vector has a U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA-Gly repeat; and a gene encoding cas9 controlled by Ptef1 and Ttef1DepositorInsertscas9
pyrG
U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSP1101
Plasmid#65773PurposeHuman expression vector for SpCas9 VRER variant: CMV-T7-humanSpCas9(D1135V/G1218R/R1335E/T1337R)-NLS-3xFLAG (VRER variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/G1218R/R1335E/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, G1218R, R1335E, and T1337R mutations in C…PromoterCMV & T7Available sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC19-E3CY56
Plasmid#103075PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE3CY56(Cas9 coding gene from Aminomonas paucivorans DSM 12260)
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-E6MBW6
Plasmid#103102PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE6MBW6(Cas9 coding gene from Staphylococcus lugdunensis M23590)
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-G2ZYP2
Plasmid#103110PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertG2ZYP2(Cas9 coding gene from Ralstonia syzygii R24)
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q927P4
Plasmid#103131PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ927P4(Cas9 coding gene from Listeria innocua serovar 6a (strain CLIP 11262))
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-B2UP49_GFP
Plasmid#103071PurposeCas9 coding gene template with optimized sequence for human codon usage, also expresses EGFPDepositorInsertB2UP49(Cas9 coding gene from Akkermansia muciniphila (strain ATCC BAA-835))
UseCRISPRTagsExpressionMammalianMutationhuman codon-optimizedPromoterCMVAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only