We narrowed to 7,295 results for: CAD;
-
Plasmid#188593PurposeFlag-tagged Nibbler variants expression in Drosophila S2 cellsDepositorAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pAFMW-Nbr
Plasmid#188584PurposeFlag-tagged Nibbler variants expression in Drosophila S2 cellsDepositorAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuetG-DmDCP1_328-366 (MCSII)-mut1_G
Plasmid#146403PurposeBacterial Expression of DmDCP1_328-366-mut1DepositorInsertDmDCP1_328-366-mut1 (Dcp1 Fly)
ExpressionBacterialAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuetG-DmDCP1_328-366 (MCSII)-mut2_G
Plasmid#146404PurposeBacterial Expression of DmDCP1_328-366-mut2DepositorInsertDmDCP1_328-366-mut2 (Dcp1 Fly)
ExpressionBacterialAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuetG-DmDCP1_328-366 (MCSII)-mut3_G
Plasmid#146405PurposeBacterial Expression of DmDCP1_328-366-mut3DepositorInsertDmDCP1_328-366-mut3 (Dcp1 Fly)
ExpressionBacterialAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuetG-DmDCP1_328-366 (MCSII)-WT_G
Plasmid#146406PurposeBacterial Expression of DmDCP1_328-366DepositorInsertDmDCP1_328-366 (Dcp1 Fly)
ExpressionBacterialAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET11-PC(75-228)-H6
Plasmid#183779PurposeExpress PC(75-228)-H6 in E. coli. PC(75-228)-H6 was used for GST-CBP pull-down assays.DepositorAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mSpata33-PA
Plasmid#179129PurposeExpression vector of mouse spermatogenesis associated 33 (Spata33) tagged with PA at C-terminus, CAG promoter, rabbit globin poly(A) signal.DepositorAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBS-KS-attB1-2-PT-SA-SD-0-mTagBFP2(11x7)
Plasmid#172064PurposeProtein trap plasmid for inserting mTagBFP2(11x7) into a phase 0 coding intronDepositorInsertmTagBFP2(11x7)
ExpressionInsectAvailable SinceOct. 20, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-TREtight-H2b-emiRFP670-P2A-TEVP
Plasmid#174379PurposeAAV virus for expressing TEVP and H2b-emiRFP670DepositorInsertTEVP
UseAAVAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRV∆G-N*PEST-4Cre
Plasmid#174381PurposeRabies vector for expressing Cre recombinase and N gene with a stop codon before PEST domainDepositorInsertCre recombinase
ExpressionMammalianAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
Mdn1-deltaC
Plasmid#171603PurposeExpresses S. pombe Mdn1 a.a. 1-3911 in insect cells.DepositorInsertMdn1
TagsHis6 tagExpressionInsectMutationC-terminal deletion; a.a. 1-3911 onlyAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLIC-His-GBAi
Plasmid#171755PurposeFor the expression of His-GBAi in bacteriaDepositorInsertGBAi
TagsHisExpressionBacterialAvailable SinceJune 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMRBad-Z-C-DiB-RM
Plasmid#168477PurposeC-fragment of the DiB-RM‐split‐Zip protein. This plasmid needs to be co-transformed with Plasmid 168475: pET11a-Z-N-DiB-RM to obtain DiB-RM‐split-Zip proteinDepositorInsertLeucine Zipper + C-fragment of DiB-RM
ExpressionBacterialPromoteraraBADAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET11a-Z-N-DiB-RM
Plasmid#168475PurposeN-fragment of the DiB-RM‐split‐Zip protein. This plasmid needs to be co-transformed with Plasmid 168477: pMRBad-Z-C-DiB-RM to obtain DiB-RM‐split-Zip proteinDepositorInsertN-fragment of DiB-RM + Leucine Zipper
TagsHis-tagExpressionBacterialPromoterT7Available SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (E12,14A)-mVenus
Plasmid#168499PurposeMammalian expression of the E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K8,9R)-mVenus
Plasmid#168498PurposeMammalian expression of the K8,9R mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K8,9R mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN(K8,9A)-mPAGFP
Plasmid#168494PurposeMammalian expression of the K8,9A mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.DepositorInsertK8,9A mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only