We narrowed to 968 results for: Gatc
-
Plasmid#90734Purpose3rd generation lentiviral gRNA plasmid targeting human LIN52DepositorInsertLIN52 (Guide Designation D5.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX330_MED13_iso1_1
Plasmid#135751PurposeEncodes gRNA for 3' target of human MED13_iso1DepositorAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
TUBB F2.4 gRNA
Plasmid#90925Purpose3rd generation lentiviral gRNA plasmid targeting human TUBBDepositorInsertTUBB (Guide Designation F2.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-sh-Myocardin
Plasmid#100769PurposeLentiviral expression of shRNA targeting MYOCDDepositorInsertLenti-sh-Myocardin
UseLentiviralExpressionMammalianPromoterhU6Available SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
ORC1 G2.1 gRNA
Plasmid#90821Purpose3rd generation lentiviral gRNA plasmid targeting human ORC1DepositorInsertORC1 (Guide Designation G2.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
HOXD12 (murine) HIS-tag pET
Plasmid#8553DepositorInsertHOXD12 (Hoxd12 Mouse)
TagsHis and T7ExpressionBacterialMutationFusion sequence is: ggatccATGAvailable SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
MSH6 E7.3 gRNA
Plasmid#90772Purpose3rd generation lentiviral gRNA plasmid targeting human MSH6DepositorInsertMSH6 (Guide Designation E7.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-Eif4a1-L
Plasmid#122346PurposeExpresses sgRNA targeting mouse Eif4a1 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Eif4a1
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
SKA1 H3.1 gRNA
Plasmid#90888Purpose3rd generation lentiviral gRNA plasmid targeting human SKA1DepositorInsertSKA1 (Guide Designation H3.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
AURKB A3.4 gRNA
Plasmid#90546Purpose3rd generation lentiviral gRNA plasmid targeting human AURKBDepositorInsertAURKB (Guide Designation A3.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
NUP107 F7.2 gRNA
Plasmid#90810Purpose3rd generation lentiviral gRNA plasmid targeting human NUP107DepositorInsertNUP107 (Guide Designation F7.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
CDCA5 C9.4 gRNA
Plasmid#90600Purpose3rd generation lentiviral gRNA plasmid targeting human CDCA5DepositorInsertCDCA5 (Guide Designation C9.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
ASF1B A3.2 gRNA
Plasmid#90534Purpose3rd generation lentiviral gRNA plasmid targeting human ASF1BDepositorInsertASF1B (Guide Designation A3.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
TUBE1 F6.4 gRNA
Plasmid#90929Purpose3rd generation lentiviral gRNA plasmid targeting human TUBE1DepositorInsertTUBE1 (Guide Designation F6.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_D11 (pAVA3773)
Plasmid#239310PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and a non-targeting sgRNA as control(-)DepositorInsertU6-driven non-targeting sgRNA Control(-)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-Fgf5Pro
Plasmid#227479Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-Fgf5Pro
Plasmid#227480Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-Fgf5Pro
Plasmid#227481Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(B)
Plasmid#236041PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only