We narrowed to 11,185 results for: AGA
-
Plasmid#126746Purposevector for replacing the promoter of FAS1 coding geneDepositorInsertfas1 upstream
Tags6xHisExpressionYeastPromoterHXT1Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR_Trf2
Plasmid#125159PurposeGateway entry cloneDepositorInsertTrf2 (Trf2 Fly)
UseGateway entry vectorAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
gamma2 UTR shRNA (shRNA4)
Plasmid#120796PurposeshRNA targeting the 3'-untranslated region (UTR) of the gamma2 mRNADepositorInsertGABRG2 shRNA (Gabrg2 Rat)
UseRNAiAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pGEX-4T1-MYB-TAD(251-327)
Plasmid#105619Purposebacterially express GST tagged MYB TADDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G10-R20
Plasmid#101819PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
PCDNA3-N3FLAG-TAF12-HFD(50-130)
Plasmid#105615Purposetransient express TAF12 HFD with 3*FLAG tag at N terminal in HEK 293T cellsDepositorInsertTAF12-HFD amino acid 50-130 with FLAG tag (Taf12 Mouse)
Tags3*FLAGExpressionMammalianPromoterCMVAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
PCDNA3-TADA1-HFD(140-230)
Plasmid#105984Purposetransient express TADA1-HFD fragment in HEK 293T cellsDepositorAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC27
Plasmid#104801PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr4g020620 (Pho2ab). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr4g020620
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1 mSesn2 (1190)
Plasmid#66916Purposebacterial expression of mouse Sesn2DepositorAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G14-R20
Plasmid#101821PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G11-R20
Plasmid#101820PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G20-R18
Plasmid#101817PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G14-R18
Plasmid#101816PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G11-R18
Plasmid#101815PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G10-R18
Plasmid#101814PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN277
Plasmid#91648PurposeExpress sgRNA targeting human PLCH2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
hSTARR-seq_SCP1 vector_blocking 2
Plasmid#99317PurposeVector to measure enhancer activity of candidates from a DNA library by STARR-seq.DepositorTypeEmpty backboneUseHstarr-seq screening vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSTAP-seq_fly-ssp3
Plasmid#86382PurposeVector to measure enhancer responsiveness of candidates from a genomic library (cloned instead of the core promoter) by determining the abundance of transcripts originating from each candidate.DepositorInsertD. melanogaster ssp3 enhancer
UseStap-seq screening vectorAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only