We narrowed to 7,268 results for: gan
-
Plasmid#229867PurposeEntry vector with cGAL[cGAL(DBD)-linker-QFAD]-tbb-3'UTR in slot 5 (for SapTrap assembly)DepositorInsertcGAL[cGAL(DBD)-linker-QFAD]-tbb-3'UTR
ExpressionWormAvailable sinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1643
Plasmid#229876Purposegene trap RMCE plasmid with Tet-On[rTetR-linker-QFAD]-act-4 3' UTR::SEC cloned in the destination vector pHW1133 to swap driver via RMCEDepositorInsertTet-On[rTetR-linker-QFAD]-act-4 3' UTR::SEC
ExpressionWormAvailable sinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1222
Plasmid#229874Purposegene trap RMCE plasmid with QF2[QF(DBD)-linker-QFAD]-act-4 3'UTR::SEC cloned in the destination vector pHW1133 to swap driver via RMCEDepositorInsertQF2[QF(DBD)-linker-QFAD]-act-4 3'UTR::SEC
ExpressionWormAvailable sinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1177
Plasmid#229872Purposegene trap RMCE plasmid with Tet-Off[TetR-linker-QFAD]-act-4 3'UTR::SEC cloned in the destination vector pHW1133 to swap driver via RMCEDepositorInsertTet-Off[TetR-QFAD]-act-4 3'UTR::SEC
ExpressionWormAvailable sinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available sinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHIT520
Plasmid#204519PurposeBacterial expression of CEC-8 N-terminal fragment with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertN-terminal fragment of cec-8 (C. elegans) (Y55B1BR.3 Nematode)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable sinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT320
Plasmid#204517PurposeBacterial expression of HIM-1 internal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertInternal fragment of him-1 (C. elegans) (him-1 Nematode)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable sinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-CeAIN2-del254-400_P
Plasmid#147232PurposeInsect Expression of CeAIN2-del254-400DepositorInsertCeAIN2-del254-400
ExpressionInsectAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-CeAIN2-del254-400_O
Plasmid#147140PurposeInsect Expression of CeAAIN2-del254-400DepositorInsertCeAAIN2-del254-400
ExpressionInsectAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2365 - Intron GG1 - 250bp no PATC
Plasmid#159883PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG1 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2345 - Intron GG2 - 250bp no PATC
Plasmid#159884PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG2 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2366 - intron GG3 - 250bp no PATC
Plasmid#159885PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertintron GG3 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1948
Plasmid#154340PurposeEnhancer reporterDepositorInsertpes-10delta::SV40 NLS::mScarlet_I::PEST(dpi)::-tbb-2 3'UTR
ExpressionWormMutationSilent mutations to remove piRNA sitesAvailable sinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
DeltaNIRD KVS-1
Plasmid#113069PurposeExpresses worm truncated KVS1.2 in mammalian cellsDepositorInsertK+ voltage sensitive channel subunit 1.2 (kvs-1 Nematode)
ExpressionMammalianMutationfirst 40 AA deletionAvailable sinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#80
Plasmid#110875PurposeExpresses the C. elegans acy-1 cDNA in body wall muscleDepositorInsertsmyo-3 promoter
acy-1 cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
ExpressionBacterialAvailable sinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::lite-1G::SL2::his-24::tagBFP
Plasmid#232610PurposePan-neuronal expression of 'LITE-1' using a genomic fragment and fluorophore 'tagBFP', regulated by rab-3 promoter and unc-54 3' UTRDepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::prdx-2G::SL2::his-24::tagRFP
Plasmid#232609PurposePan-neuronal expression of 'PRDX-2' using a genomic fragment and fluorophore 'tagRFP', regulated by rab-3 promoter and unc-54 3' UTRDepositorAvailable sinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1223
Plasmid#229875Purposegene trap RMCE plasmid with LexA[LexA(DBD)-linker-QFAD]-act-4 3'UTR::SEC cloned in the destination vector pHW1133 to swap driver via RMCEDepositorInsertLexA[LexA(DBD)-linker-QFAD]-act-4 3'UTR::SEC
ExpressionWormAvailable sinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1134
Plasmid#229870Purposegene trap RMCE plasmid with cGAL[cGAL(DBD)-linker-QFAD]-tbb-2 3'UTR::SEC cloned in the destination vector pHW1133 to swap driver via RMCEDepositorInsertcGAL[cGAL(DBD)-linker-QFAD]-tbb-2 3'UTR::SEC
ExpressionWormAvailable sinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHIT186
Plasmid#204513PurposeBacterial expression of CSR-1 PAZ domain with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertPAZ domain of csr-1 (C. elegans) (csr-1 Nematode)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only