We narrowed to 41,115 results for: KAN
-
Plasmid#114705PurposeExpress NuMA(1-413)-RFP-Nano from Rosa 26 locusDepositorInsertNuMA(1-413)-RFP-Nano
Available SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTK664
Plasmid#114704PurposeExpress NuMA(1-505)-RFP-Nano from Rosa 26 locusDepositorInsertNuMA(1-505)-RFP-Nano
Available SinceOct. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTK660
Plasmid#114702PurposeExpress NuMA(1-705)4A-RFP-Nano from Rosa 26 locusDepositorInsertNuMA(1-705)4A-RFP-Nano
Available SinceOct. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTK631
Plasmid#114701PurposeExpress NuMA(1-705)-RFP-Nano from Rosa 26 locusDepositorInsertNuMA(1-705)-RFP-Nano
Available SinceOct. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTK525
Plasmid#114691PurposesgRNA for p150's C-terminal locusDepositorInsertp150 sgRNA
Available SinceOct. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTK371
Plasmid#114693PurposesgRNA for DHC's N-terminal locusDepositorInsertDHC-N sgRNA
Available SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
P0050::kaiBC
Plasmid#101828Purposedrives expression of kaiBC from an rpaA-independent promoterDepositorInsertkanamycin casette and p0050 promoter
UseCloning vectorAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
zwf-fbp-opcA-
Plasmid#101839Purposedeletes zwf_fbp_opcA locusDepositorInsertKanamycin casette (in place of synpcc7942_2333-2335 operon)
UseCloning vectorAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
p201N 1510a.2
Plasmid#55770PurposeContains soybean miRNA miR1510a.2 recognition sequence (ATGGGTGGAATAGGGAAAACAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceOct. 23, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 5770
Plasmid#55772PurposeContains soybean miRNA miR5770 recognition sequence (TCTTGTCCAAACCATAGTCCAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 1510
Plasmid#55771PurposeContains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 3514
Plasmid#55769PurposeContains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceAug. 21, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKS100
Plasmid#24630DepositorInsertfadD
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 11, 2010AvailabilityAcademic Institutions and Nonprofits only -
RF10
Bacterial Strain#62076PurposeBL21(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. lysA genes deleted.DepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
RF8
Bacterial Strain#62075PurposeBL21(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. asnA asnB genes deleted.DepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
RF6
Bacterial Strain#62074PurposeBL21(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. proC gene deleted.DepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
RF1
Bacterial Strain#61962PurposeBL21(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. glyA gene deletedDepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
YM138
Bacterial Strain#61953PurposeC43(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. cysE gene deleted.DepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
RF11
Bacterial Strain#61961PurposeC43(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. metA gene deletedDepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
RF2
Bacterial Strain#62070PurposeBL21(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. thrC gene deletedDepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only