We narrowed to 4,396 results for: 256
-
Plasmid#75804Purpose3rd generation lentiviral gRNA plasmid targeting human CMPK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
CMPK2 gRNA (BRDN0001145007)
Plasmid#75805Purpose3rd generation lentiviral gRNA plasmid targeting human CMPK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CMPK2 gRNA (BRDN0001147027)
Plasmid#75806Purpose3rd generation lentiviral gRNA plasmid targeting human CMPK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CCR5-SZ218a QTY
Plasmid#162444PurposeExpression in E coli and perform ligand binding in solutionDepositorInsertC-C chemokine receptor type 5 (CCR5 Human)
Tagshis-tagExpressionBacterialMutationAll L, I, V, F in the transmembrane region mutate…AvailabilityAcademic Institutions and Nonprofits only -
Anti-LRRTM4 [N205B/22R]
Plasmid#128636PurposeMammalian Expression Plasmid of anti-LRRTM4 (Human). Derived from hybridoma N205B/22.DepositorInsertanti-LRRTM4 (Human) recombinant mouse monoclonal antibody (LRRTM4 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
FUW-tetO-YAPS94A
Plasmid#84010Purposeexpresses a TEAD-binding mutant of YAP (YAPS94A) in mammalian cells under the control of a doxycycline-inducible promoterDepositorInsertYAP1 (siRNA insensitive) (YAP1 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationS94APromoterTRE-CMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T1-TEV-HsFbxo7-129-398/Skp1
Plasmid#202592PurposeBacterial expression of HsFbxo7-129-398 and HsSkp1DepositorTagsGST, TEVExpressionBacterialMutationaa 129-398 onlyAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP.mIKKα
Plasmid#74413PurposeExpresses mouse eGFP-IKKα in mammalian cellsDepositorAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001145502)
Plasmid#76851Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001148405)
Plasmid#76852Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001146399)
Plasmid#76853Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001148106)
Plasmid#76854Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-Tmem119 [L128/18R]
Plasmid#225367PurposeMammalian Expression Plasmid of anti-Tmem119 (Mouse) IgG2a R-mAb. Derived from hybridoma L128/18.DepositorInsertAnti-Tmem119 (Mus musculus) recombinant (Mouse) monoclonal antibody. (Tmem119 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_FURIN_WT
Plasmid#82122PurposeGateway Donor vector containing FURIN , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pIRES2-smGFP-Kv2.1
Plasmid#131709PurposeExpresses Kv2.1 in mammalian cellsDepositorAvailable SinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only