We narrowed to 7,512 results for: mcherry
-
Plasmid#169042PurposeMiddle entry vector for Gateway cloning that contains an mCherry fused with an optimized photoactivatable Rac1 gene insertDepositorInsertPA-Rac-1 (RAC1 Human, Avena sativa (oat))
UseGateway entry cloning vectorTags6X His and Fused with mCherryMutationRac1 starts at I4 and contains mutations Q61L, E9…Available sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-TPD52
Plasmid#172456PurposeExpression of Tumor Protein D52 (TPD52) with N-terminal mCherry-FKBP tagDepositorAvailable sinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Stx3-mCherry
Plasmid#190890PurposeExpresses syntaxin 3 fused to mCherry in mammalian cellsDepositorAvailable sinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-CT-Tagging
Plasmid#165869PurposeTemplate for amplification of mcherry C-terminal tagging cassetteDepositorInsertVector - CT Tagging
UseSynthetic BiologyAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-NT-Tagging
Plasmid#165870PurposeTemplate for amplification of mCherry N-terminal tagging cassetteDepositorInsertVector - NT Tagging
UseSynthetic BiologyAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBZ202-pU6-sgBFP-An_CBh-sv40NLS-Cas9-Sa163RT-NLS-T2A-mCherry
Plasmid#170184PurposeExpression vector for a sgRNA against BFP and spCas9-Sa163 RT fusion protein linked to mCherry via a T2A peptide. Donor template An was inserted in the Retron Sa163 msr-msd region by SpeI and AvrII.DepositorInsertsSa163 RT
Retron Sa163 msr-msd
BFP-to-GFP conversion donor template An
UseCRISPRTagsNLSExpressionMammalianPromoterCBh and hU6Available sinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
JDW 1061 (pLenti6.2_CMV_GATA1_P2A_H2A_mCherry)
Plasmid#233543PurposeA CMV driven human GATA1 followed by a P2A cleavage peptide and an H2A mCherry fusion protein.DepositorPublicationAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmCherry_I3
Plasmid#239340PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with mCherry in mammalian cells. Assembles into nanocages tagged with 60 FPs.DepositorInsertI3-01
TagsmCherryExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKK-BI16-TEV-mCherry
Plasmid#105800PurposeConcomitant expression of two proteins. One protein is expressed with mCherry fusion tag (at the C-terminus), cleavable by TEV protease; second tag introduced by user.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mCherryExpressionMammalianAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-PytR(A2.1)-mCherry
Plasmid#204869PurposeExpresses pyrrolysyl tRNA variant "A2.1" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertM. mazei pyrrolysyl tRNA mutant "A2.1"
UseAAVExpressionMammalianMutationU25C; A3G, A4G, T65C, T66C, T67TPromoterU6Available sinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamkII-bPac(WT)-mCherry-minWPRE.sbd
Plasmid#118278PurposeExpresses bPAC(WT)-mCherry under a minimal CamKII PromoterDepositorInsertbPAC(WT)
UseAAVTagsmCherry and mycPromoterCamKIIAvailable sinceJune 18, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHR-GAL4-IL10-IRES-mCherry-PGK-BFP
Plasmid#223209PurposeLentiviral vector - mCherry reporter and IL10 for Gal4DBDVP64 synNotch receptors with a constitutive BFPDepositorAvailable sinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-SRRM2-gRNA
Plasmid#238251PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to SRRM2 locusDepositorInsertSRRM2
UseCRISPRAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-TCOF1-gRNA
Plasmid#237633PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to TCOF1 locusDepositorAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3A2-mCherry
Plasmid#73425PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3A2.DepositorInsertPromoter 3A2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3A2 (orthogonal T7-lac variant)Available sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3F2-mCherry
Plasmid#73418PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3F2.DepositorInsertPromoter 3F2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3F2 (orthogonal T7-lac variant)Available sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-EGFP-P2A-mCherry
Plasmid#203868PurposeTet-inducible lentiviral plasmid expressing EGFP-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertEGFP
ExpressionMammalianAvailable sinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-EcYtR-mCherry
Plasmid#217362PurposeExpresses E. coli tyrosine tRNA and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli tyrosine tRNA
UseAAVExpressionMammalianPromoterU6Available sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-PytR-mCherry
Plasmid#204868PurposeExpresses pyrrolysyl tRNA and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertM. mazei pyrrolysyl tRNA
UseAAVExpressionMammalianMutationU25CPromoterU6Available sinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only