We narrowed to 26,286 results for: grna
-
Plasmid#225840PurposeTn6677 transposon with guide RNA (mscar T03 spacer) and spec resistance expression.DepositorPublicationInsertCRISPRt transposon with gRNA expression cassette (mScar-T03 guide)
UseSynthetic Biology; Crispr associated transpositio…ExpressionBacterialAvailable sinceAug. 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT36
Plasmid#223408PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB4
Plasmid#197357PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-bleo-ErbB4
Plasmid#197353PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB1
Plasmid#197354PurposeA knock-out vector for dog ErbB1.DepositorInsertA gRNA targeting the dog EGFR gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB2
Plasmid#197355PurposeA knock-out vector for dog ErbB2.DepositorInsertA gRNA targeting the dog ERBB2 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX458-dErbB3
Plasmid#197356PurposeA knock-out vector for dog ErbB3.DepositorInsertA gRNA targeting the dog ERBB3 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiPOLR2D
Plasmid#202445PurposeExpression of a CRISPRi guide targeting POLR2DDepositorAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003-sgUBA6
Plasmid#202440PurposeExpression of a guide RNA targeting UBA6DepositorAvailable sinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-1
Plasmid#124474PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-1_gRNA (BLK Human)
ExpressionMammalianAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-2
Plasmid#124475PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-2_gRNA (BLK Human)
ExpressionMammalianAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-3
Plasmid#124476PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-3_gRNA (BLK Human)
ExpressionMammalianAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-4
Plasmid#124477PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-4_gRNA (BLK Human)
ExpressionMammalianAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E3-3
Plasmid#124484PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E3-3_gRNA (BLK Human)
ExpressionMammalianAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Skil-gRNA1
Plasmid#180370Purposetargeting mouse Skil/SnoN geneDepositorAvailable sinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable sinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX552-mScn8a-3xHA-Syn-smFP-flag
Plasmid#182563PurposeFor mouse Nav1.6 knockin with 3xHA at the C-terminalDepositorInsertsmouse Scn8a gRNA and 3xHA donor DNA
smFP-flag
UseAAV and CRISPRPromoterEF1 and U6Available sinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX552-mScn8a-3xV5-EF1-smFP-flag
Plasmid#182562PurposeFor mouse Nav1.6 knockin with 3xV5 at the C-terminalDepositorInsertsmouse Scn8a gRNA and 3xV5 donor DNA
smFP-flag
UseAAV and CRISPRPromoterEF1 and U6Available sinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-exon1
Plasmid#177261PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable sinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-5’UTR
Plasmid#177260PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable sinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only