We narrowed to 6,491 results for: cat.2
-
Plasmid#190626PurposeBacterial expression of genetically encoded calcium indicator SCWDepositorInsertSCW
ExpressionBacterialAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP650
Plasmid#135000PurposeVP64-m6A Reader. Activates transcription near Gm6ATC sites. pUBC-DpnI(aa146-254)-VP64-V5 pGK-ZeoRDepositorInsertpUBC-DpnI(aa146-254)-VP64-V5 pGK-ZeoR
UseLentiviral and Synthetic BiologyTagsDpnI(aa146-254), V5 tag, and VP-64ExpressionMammalianMutationDpnI truncated to aa146-254Available SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-lpoB
Plasmid#89959PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting lpoB.DepositorInsertlpoB gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-RCC
Plasmid#190635PurposeMammalian expression of genetically encoded calcium indicator RCCDepositorInsertRCC
ExpressionMammalianAvailable SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-SCcpV
Plasmid#190636PurposeMammalian expression of genetically encoded calcium indicator SCcpVDepositorInsertSCcpV
ExpressionMammalianAvailable SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-torZ
Plasmid#89956PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting torZ.DepositorInserttorZ gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-arsB
Plasmid#89952PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting arsB.DepositorInsertarsB gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
9336-E24
Plasmid#234307PurposeGateway ORF Entry clone of human SMAD3 truncated with stop codon (for native or N-terminal fusions); C-term truncation to delete phosphorylation sitesDepositorInsertSMAD3 truncated (SMAD3 Human)
UseGateway entry cloneMutationdel(422-425); C-term truncation to delete phospho…Available SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF3520
Plasmid#144996PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0257
Plasmid#141560PurposeLentiviral vector for overexpressing the TCF4 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3519
Plasmid#144995PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6p-1_GST-DmKHC[1-421]_1xmNeonGreen
Plasmid#196974PurposeBacterial expression plasmid for GST-based purification of Drosophila melanogaster kinesin heavy chain [1-421] with C-terminal mNeonGreen tag and cleavable N-terminal GST tagDepositorAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a_DmKHC[1-421]-SNAP-6xHis
Plasmid#196975PurposeBacterial expression plasmid for His tag-based purification of Drosophila melanogaster kinesin heavy chain [1-421] with C-terminal SNAP tag and C-terminal 6xHis tagDepositorAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
p2xp53_RE
Plasmid#118053PurposeGBPart - Operator/DNA Response element - 2 copies of the p53 DNA binding motifDepositorInsert2 copies of the p53 DNA binding motif
UseSynthetic Biology; Domestication of dna parts for…Available SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pGP-AAV-syn-FLEX-Volton2-ST-WPRE (AAV1)
Viral Prep#172907-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-Volton2-ST-WPRE (#172907). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-Volton2-ST-WPRE plasmid DNA. Cre-dependent, Syn-driven expression of the voltage sensor Voltron2-ST containing a soma localization targeting sequence. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-Ace2N-4AA-mNeon-ST A122D WPRE (AAV1)
Viral Prep#172908-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-Ace2N-4AA-mNeon-ST A122D WPRE (#172908). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-Ace2N-4AA-mNeon-ST A122D WPRE plasmid DNA. Syn-driven, Cre-dependent Ace2N-4AA-mNeon-ST A122D expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmNeon (Cre-dependent)Available SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB2076 pAAV REPAIR.t1
Plasmid#176323PurposepAAV EFS-HIVNES-dCas13bt1- (GGS)2-huADAR2(E488Q)-3xHA BGHpolyA::U6-BpiI-Cas13bt1 DR (full REPAIR.t1 + crRNA expression for AAV production)DepositorInsertshuman codon optimized Cas13bt1 (catalytically inactivated)
huADAR2dd(E488Q) (ADARB1 Human)
Cas13bt1 crRNA + BpiI cloning site
UseAAV and CRISPRTags3xHA and HIV NESExpressionMammalianMutationE488Q, only the deaminase domain (aa 276-702 are …PromoterEFS (short EF1alpha) and hU6Available SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXs-Puro- MLL3-PRKAG2
Plasmid#69473PurposeExpresses MLL3-PRKAG2 fusion geneDepositorAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only