We narrowed to 4,491 results for: 256
-
Plasmid#163674PurposeExpresses a ST6GAL1 mutant with 19 amino acids in its TMD in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 mutant (ST6GAL1 Human)
TagsGFPExpressionMammalianMutationFor this partial length ST chimera, two restricti…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
TMD20
Plasmid#163675PurposeExpresses a ST6GAL1 mutant with 20 amino acids in its TMD in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 mutant (ST6GAL1 Human)
TagsGFPExpressionMammalianMutationFor this partial length ST chimera, two restricti…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
TMD21
Plasmid#163676PurposeExpresses a ST6GAL1 mutant with 21 amino acids in its TMD in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 mutant (ST6GAL1 Human)
TagsGFPExpressionMammalianMutationFor this partial length ST chimera, two restricti…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
TMD22
Plasmid#163677PurposeExpresses a ST6GAL1 mutant with 22 amino acids in its TMD in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 mutant (ST6GAL1 Human)
TagsGFPExpressionMammalianMutationFor this partial length ST chimera, two restricti…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
TMD24
Plasmid#163678PurposeExpresses a ST6GAL1 mutant with 24 amino acids in its TMD in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 mutant (ST6GAL1 Human)
TagsGFPExpressionMammalianMutationFor this partial length ST chimera, two restricti…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
FKBP-ST*-GFP
Plasmid#163669PurposeExpresses FKBP tagged partial length ST in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 (first 113 amino acids) (ST6GAL1 Human)
TagsFK506 binding protein (FKBP) and GFPExpressionMammalianMutationThis chimera contains the first 113 amino acids o…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-2xMARS-nGFP-puro
Plasmid#205238PurposeLentiviral vector encoding two repeats of PLEKHA5 aa 143-271 (K163A and R164A) fused to a HA-tagged GFP nanobodyDepositorInsert2xPLEKHA5(143-271)-K163A/R164A-HA-nGFP (PLEKHA5 Human)
UseLentiviralTagsHA, Nuclear Export Sequence, mScarlet-i, and nGFP…ExpressionMammalianMutationamino acids 143-271 of PLEKHA5 (GenBank reference…PromoterCMVAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-tetO-wtYAP
Plasmid#84009Purposeexpresses wtYAP in mammalian cells under the control of a doxycycline-inducible promoterDepositorInsertYAP1 (siRNA insensitive) (YAP1 Human)
UseLentiviralTagsFLAGExpressionMammalianPromoterTRE-CMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX335A_hCas9(D10A)_IRF8gRNA1
Plasmid#89719PurposeKnockout IRF8 in human cellsDepositorAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX335A_hCas9(D10A)_IRF8gRNA2
Plasmid#89720PurposeKnockout IRF8 in human cellsDepositorAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pChuk
Plasmid#87033Purposeexpress IKKalpha in mammalian cellsDepositorAvailable SinceJuly 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
ARAF gRNA (BRDN0001148242)
Plasmid#75661Purpose3rd generation lentiviral gRNA plasmid targeting human ARAFDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MELK gRNA (BRDN0001144817)
Plasmid#75667Purpose3rd generation lentiviral gRNA plasmid targeting human MELKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MELK gRNA (BRDN0001145853)
Plasmid#75668Purpose3rd generation lentiviral gRNA plasmid targeting human MELKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MELK gRNA (BRDN0001146713)
Plasmid#75669Purpose3rd generation lentiviral gRNA plasmid targeting human MELKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ARAF gRNA (BRDN0001147899)
Plasmid#75660Purpose3rd generation lentiviral gRNA plasmid targeting human ARAFDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ARAF gRNA (BRDN0001148605)
Plasmid#75662Purpose3rd generation lentiviral gRNA plasmid targeting human ARAFDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK3 gRNA (BRDN0001147084)
Plasmid#75975Purpose3rd generation lentiviral gRNA plasmid targeting human STK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only