We narrowed to 7,765 results for: Pol
-
Plasmid#188557PurposeBinary vector for the expression of Citrine with MpIGPDm selective marker in Marchantia polymorpha (igpd mutants) .DepositorInsertCitrine and MpIGPDm
UseCRISPR and Gateway CloningAvailable sinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR207-MpTubulin beta 3
Plasmid#100594PurposeGateway entry vector for MpTubulin beta 3DepositorInsertMpTubulin beta 3
Available sinceFeb. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZB604_pT7-sfGFP
Plasmid#228510PurposeBacterial Hybrid Reporter Plasmid (sfGFP), pT7-sfGFPDepositorInsertsfGFP
UseSynthetic BiologyPromoterT7Available sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
MGS0156_pET29b
Plasmid#215410PurposeExpression construct for MGS0156 gene, codon optimized for expression in E. coliDepositorInsertMGS0156
ExpressionBacterialAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GatA_pET29b
Plasmid#215406PurposeExpression construct for GatA gene, codon optimized for expression in E. coliDepositorInsertGatA
ExpressionBacterialAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCsB
Plasmid#136068PurposeAcceptor plasmid for even level position 2, lacZ blue-white screeningDepositorInsertlacZ
UseSynthetic BiologyExpressionPlantAvailable sinceNov. 30, 2021AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pCsC
Plasmid#136069PurposeAcceptor plasmid for even level position 3, lacZ blue-white screeningDepositorInsertlacZ
UseSynthetic BiologyExpressionPlantAvailable sinceNov. 30, 2021AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pCsE
Plasmid#136070PurposeAcceptor plasmid for even level position 4, lacZ blue-white screeningDepositorInsertlacZ
UseSynthetic BiologyExpressionPlantAvailable sinceNov. 30, 2021AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pST50Trc4-HPCHISNDHFR
Plasmid#64002PurposePosition 4 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable double tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTags6xHis & Protein C (HPC); TEV cleavableExpressionBacterialPromoterT7Available sinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc1-STRHISNDHFR
Plasmid#63946PurposePosition 1 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable double tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTags6xHis & Strep II (STR); TEV cleavableExpressionBacterialPromoterT7Available sinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc2-HPCHISNDHFR
Plasmid#63966PurposePosition 2 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable double tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTags6xHis & Protein C (HPC); TEV cleavableExpressionBacterialPromoterT7Available sinceOct. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Abr in pAcG2T
Plasmid#38162DepositorAvailable sinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMpGWBhis03-Citrine-NLS
Plasmid#188558PurposeBinary vector for the expression of Citrine-NLS with MpIGPDm selective marker in Marchantia polymorpha (igpd mutants) .DepositorInsertCitrine-NLS and MpIGPDm
UseCRISPR and Gateway CloningAvailable sinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPS3911
Plasmid#113330Purposecontrol for Hermes transposition; TIR-flanked LEU2, transposase absentDepositorInsertbeta-isopropyl malate dehydrogenase
ExpressionYeastAvailable sinceAug. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
nTurboID-HA_pEarleyGate100
Plasmid#247582PurposeA Gateway-compatible vector harboring a nTurboID–HA fusion and conferring BASTA resistance in plantsDepositorInsertnTurboID
TagsHAExpressionPlantAvailable sinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pATUBR
Plasmid#245488PurposeBinary Plasmid for plant transformation expressing RUBY from the Arabidopsis thaliana polyubiquitin 10 gene promoter and the terminator from the pea RBCS gene. Kanamycin plant selectionDepositorInsertpAtUBI-RUBY-tRBCS
ExpressionPlantPromoterPolyubiquitin 10 gene from Arabidopsis thalianaAvailable sinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOG-Cre
Plasmid#233265PurposePlasmid expressing Cre recombinase that is used to insert DNA CARGO into RMCE homing locus in Rosa26DepositorInsertCre recombinase
UseCre/LoxExpressionMammalianPromoterCMVAvailable sinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
C245
Plasmid#174351PurposeTemplate for making mRNA for overexpressing frog RPL3 (C-HA) in frog oocytesDepositorAvailable sinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAM292
Plasmid#226129PurposeExpression of His6-SUMO-Ub-mEos3.2-intein-CBDDepositorInsertHis6-SUMO-Ub-mEos3.2-intein-CBD
ExpressionBacterialAvailable sinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only