We narrowed to 5,969 results for: actin
-
Plasmid#183239PurposeExpression of FLAG tagged HNF1BDepositorAvailable sinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only
-
GFP-Tollip M240A,F241A
Plasmid#178051PurposeGFP fused to human Tollip cDNA carrying mutations in the CUE domain. Localisation and expression in mammalian cells.DepositorInsertToll-Interacting Protein (TOLLIP Human)
TagsGFPExpressionMammalianMutationChanged Methionine 240 to Alanine and changed Phe…PromoterCMVAvailable sinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA5FRT/TO-SVIP-Strep-HA
Plasmid#113491PurposeExpression of human SVIP with C-terminal strep-HA tagDepositorInsertSVIP (SVIP Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable sinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-TetR
Plasmid#103813PurposeBLInCR 'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationTetR: A4G (M2V)PromoterCMVAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMRX-IPU-FLAG-NEK9T210A
Plasmid#168270PurposeExpresses kinase-dead NEK9 mutant in mammalian cellsDepositorAvailable sinceMay 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA Myc-mMEKK2
Plasmid#44158DepositorAvailable sinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMVtight-HNF1A-FLAG-Hygro
Plasmid#183232PurposeLentiviral vector; Tet-on advanced system driving the expression of tagged HNF1ADepositorAvailable sinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-tagBFP-TetR
Plasmid#103797PurposeBLInCR 'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationTetR: A4G (M2V)PromoterCMVAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAFMW-Nbr-D435A/E437A
Plasmid#40829PurposeExpresses Flag, Myc tagged mutant Nbr in Drosophila cellsDepositorInsertNbr D435A/E437A (Nbr Fly)
Tags3xFLAG and 6xMycExpressionInsectMutationD435A/E437A, part of the DEDD motif; mutations p…PromoterActin5CAvailable sinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-tagBFP-hTRF1
Plasmid#103801PurposeBLInCR 'Localizer' construct that marks the telomeres and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-LacI
Plasmid#103814PurposeBLInCR 'Localizer' construct that marks lacO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationLacI: C19T (silent, L7L), T264C (silent, A88A), C…PromoterCMVAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMTB-Multibow-mB
Plasmid#60985PurposePart of Multibow set of constructs--each FP gene is initially not expressed and then adopts a permanent ON or OFF status upon Cre-mediated recombination. Encodes membrane bound EBFP2.DepositorInsertEBFP2
UseZebrafishTagsmembrane tagPromoterBactin2Available sinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMTB-Multibow-hC
Plasmid#60993PurposePart of Multibow set of constructs--each FP gene is initially not expressed and then adopts a permanent ON or OFF status upon Cre-mediated recombination. Encodes nuclear ceruleanDepositorInsertCerulean
UseZebrafishTagshistone 2B tagPromoterBactin2Available sinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMTB-Multibow-hB
Plasmid#60992PurposePart of Multibow set of constructs--each FP gene is initially not expressed and then adopts a permanent ON or OFF status upon Cre-mediated recombination. Encodes nuclear EBFP2.DepositorInsertEBFP2
UseZebrafishTagshistone 2B tagPromoterBactin2Available sinceJan. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMTB-Multibow-hG
Plasmid#60994PurposePart of Multibow set of constructs--each FP gene is initially not expressed and then adopts a permanent ON or OFF status upon Cre-mediated recombination. . Encodes nuclear EGFPDepositorInsertEGFP
UseZebrafishTagshistone 2B tagPromoterBactin2Available sinceJan. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGCG26
Plasmid#82371PurposeYFP expressed from pJ23119 in the glpK locus with gentamicin resistanceDepositorInsertYFP
PromoterPJ23119Available sinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
EGFP-fMCP
Plasmid#238908PurposeContains EGFP-fMCP fluorogenic proteinDepositorInsertEGFP-fMCP
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTK711
Plasmid#114708PurposeExpress NuMA(1-1985)-RFP-Nano from Rosa 26 locusDepositorInsertNuMA(1-1985)-RFP-Nano
Available sinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTK715
Plasmid#114698PurposeExpress NuMA(1-2115)-RFP-Nano from Rosa 26 locusDepositorInsertNuMA(1-2115)-RFP-Nano
Available sinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas34
Plasmid#82386PurposesgRNA targeting YFP expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available sinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only