We narrowed to 24,060 results for: promoter
-
Viral Prep#52925-AAV5PurposeReady-to-use AAV5 particles produced from pZac2.1 gfaABC1D-cyto-GCaMP6f (#52925). In addition to the viral particles, you will also receive purified pZac2.1 gfaABC1D-cyto-GCaMP6f plasmid DNA. gfaABC1D-driven (similar to GFAP promoter) cyto-GCaMP6f calcium sensor expression. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only
-
AAV-CAG-hChR2-H134R-tdTomato (AAV Retrograde)
Viral Prep#28017-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-CAG-hChR2-H134R-tdTomato (#28017). In addition to the viral particles, you will also receive purified AAV-CAG-hChR2-H134R-tdTomato plasmid DNA. Humanized channelrhodopsin H134R mutant fused to tdTomato, under the control of the CAG promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomatoAvailable SinceJune 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ihSyn1-DIO-tTA (AAV1)
Viral Prep#99121-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-ihSyn1-DIO-tTA (#99121). In addition to the viral particles, you will also receive purified pAAV-ihSyn1-DIO-tTA plasmid DNA. Cre-dependent expression of the tet-off transactivator from an inducible synapsin promoter. These AAV preparations are suitable purity for injection into animals.DepositorPromoterihSyn1Available SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA (AAV1)
Viral Prep#50942-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA (#50942). In addition to the viral particles, you will also receive purified pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA plasmid DNA. GCaMP6s calcium sensor and bicistronic, physically separate mRuby2 expression under a human synapsin1 promoter. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmRuby2Available SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-eGFP-2A-Cre-WPRE (AAV8)
Viral Prep#203842-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-fDIO-eGFP-2A-Cre-WPRE (#203842). In addition to the viral particles, you will also receive purified pAAV-Ef1a-fDIO-eGFP-2A-Cre-WPRE plasmid DNA. Flp-dependent Cre and EGFP expression under the EF1a promoter. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core
Plasmid#61357Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Synthetic, S. pyogenes, Human)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (D1399Y)
Plasmid#61358Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutation D1399Y) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Synthetic, S. pyogenes, Human)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; D1399Y mutation i…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGGG-AH-VRT-A2
Plasmid#163703PurposeWheat transformation vector pGoldenGreenGate (pGGG) with OsActinP:: hygromycin (hpt) selection and the full native Triticum polonicum VRT-A2 gene (native prom::genomic seq::3'UTR)DepositorInsertsOs Actin promoter :: Hygromycin resistance gene (hpt) containing CAT1 intron :: NosTerminator
Triticum polonicum VRT-A2 genomic sequence (Native promoter:: genomic sequence::3'UTR) + Nos Terminator
ExpressionPlantPromoterRice - Os Actin promoter and Triticum polonicum V…Available SinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (Y1467F)
Plasmid#61362Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inavtivating mutation Y1467F) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Synthetic, S. pyogenes, Human)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; Y1467F mutation i…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
TOPO-HIF1A
Plasmid#226452PurposeFor subcloning of human HIF1A promoter or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-KIF5A-HA-IRES-Puro
Plasmid#166952PurposeLentiviral plasmid expressing HA-tagged KIF5A protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-Nppa-EGFP
Plasmid#247327PurposeExpresses EGFP under the control of the Nppa promoterDepositorInsertEGFP under the control of the Nppa Promoter
UseAAVExpressionMammalianPromoterNppa proximal promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1557 to-1046)
Plasmid#226446PurposeFor subcloning of human EXOC3 promoter (base pairs -1557 to-1046) or for assays using M13 phageDepositorAvailable SinceSept. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-2455 to -1951)
Plasmid#226441PurposeFor subcloning of human EXOC3 promoter (base pairs -2455 to -1951) or for assays using M13 phageDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1592 to -1046)
Plasmid#226444PurposeFor subcloning of human EXOC3 promoter (base pairs -1592 to -1046) or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1591 to -1009)
Plasmid#226443PurposeFor subcloning of human EXOC3 promoter (base pairs -1591 to -1009) or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1701 to -1594)
Plasmid#226442PurposeFor subcloning of human EXOC3 promoter (base pairs -1701 to -1594) or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1592 to -1444)
Plasmid#226445PurposeFor subcloning of human EXOC3 promoter (base pairs -1592 to -1444) or for assays using M13 phageDepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1557 to-1444)
Plasmid#226447PurposeFor subcloning of human EXOC3 promoter (base pairs -1557 to-1444) or for assays using M13 phageDepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only