We narrowed to 8,396 results for: aav
-
Plasmid#220661PurposeAiE2367m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-oChIEF(E163A/T199C)-P2A-EGFP
Plasmid#51093PurposeForebrain principal neuron expression of oChIEF kinetic variant E163A/T199C with physically uncoupled EGFP fluorophoreDepositorInsertoChIEF(E163A/T199C)
UseAAVTagsP2A-EGFPExpressionMammalianMutationE163A/T199CPromoterCaMKIIaAvailable SinceMay 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV CMV-DIO-(mCherry-U6)-shRNA(anti-Crh)
Plasmid#214732PurposeExpresses shRNA against CRH, marked with mCherry, in infected and cre positive cellsDepositorInsertanti-Crh shRNA / mCherry
UseAAVAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-flex-iGABASnFR2(no bind)-WPRE
Plasmid#218879PurposeAAV-mediated expression of improved GABA sensor control (no change in fluorescence)DepositorHas ServiceAAV1 and AAV5InsertiGABASnFR2(no bind)
UseAAV and Cre/LoxExpressionMammalianMutationS99A F102G R168PPromoterSynapsinAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
AiP1530 - pAAV-AiE2115m_3xC2-minBG-SYFP2-WPRE-BGHpA
Plasmid#220657PurposeAiE2115m_3xC2 is an optimized enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eGFP-2A-TetanusToxin (Cre-OFF)
Plasmid#166611PurposeEncodes Cre-inactivated GFP-2A-Tetanus toxin light chain under control of the TREDepositorInsertEGFP-2A-Tetanus Toxin
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-actin prom-dsRed-adra2a.1227.shRNA
Plasmid#67880Purposeexpresses dsRed and shRNA to knock down adra2a receptorsDepositorInsertdsRed and shRNA to knock down the mouse adra2 receptor
UseAAVExpressionMammalianPromoterchicken beta actinAvailable SinceSept. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
AiP981-pAAV-mscRE4-minBGpromoter-EGFP-WPRE-hGHpA
Plasmid#163484PurposeDirect-expressing EGFP AAV Virus. Alias: AiP981 - pAAV-AiE2004m-minBG-EGFP-WPRE-HGHpADepositorInsertEGFP
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP1924 - pAAV-AiE2543m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214583PurposeAiE2543m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-EYFP-WPRE-HGHpA
Plasmid#20296PurposeCre-activated AAV expression of EYFPDepositorInsertEYFP
UseAAVExpressionMammalianAvailable SinceMay 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SpCas9_gRNA(RHO-P23H)-CMV-mTagBFP2_(RAS3613)
Plasmid#228252PurposepU6 (human U6) expression of SpCas9 sgRNA targeting RHO P23H mutation and pCMV expression of mTagBFP2DepositorInsertSpCas9 P23H sgRNA, mTagBFP2
ExpressionMammalianMutationn/aPromoterCMV and U6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hnEF Coff/Fon hChR2(H134R)-EYFP
Plasmid#55649PurposeCre-off/Flp-on ChR2-EYFP under the short Ef1a promoterDepositorInsertChR2(H134R)-EYFP
UseAAV; Cre off/flp on chr2-eyfpTagsEYFPExpressionMammalianPromoterShort Ef1Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{GCaMP6f}on-W3SL
Plasmid#111394PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON GCaMP6f (ultrasensitive calcium sensor), and W3SL regulatory cassette (for maximize cloning capacity)DepositorInsertsUseAAVTags6xHis, Myc, T7, and XpressExpressionMammalianPromoterhSynapsinAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-HA-KORD-IRES-mCitrine-WPREpA
Plasmid#154871PurposeHuman synapsin-1 promoter; Flp-dependent KORD-IRES-mCitrineDepositorInsertKORD-IRES-mCitrine
UseAAV; Flp-frtTagsHAExpressionMammalianPromoterHuman Synapsin-1Available SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
1255_pAAV-U6-SA-BbsI-MluI-gRNA-CB-SACas9-HA-OLLAS-spA
Plasmid#109320PurposePlasmid for AAV SaCas9 Mammalian Expression with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
AiP1969 - pAAV-AiE2563m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214597PurposeAiE2563m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-Gluc-RMA-IRES-EGFP
Plasmid#189630PurposeExpresses Gluc-RMA and EGFP in the presence of Cre recombinase. Double-floxed Gluc-RMA and EGFP for monitoring Cre-expressing neuronal populations.DepositorInsertsGaussia luciferase fused to Fc
IRES-EGFP
UseAAV, Cre/Lox, and LuciferaseTagsGluc and IgG1 FcExpressionMammalianPromoterIRES and hSynAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP1365 - pAAV-AiE2136m-minBG-SYFP2-WPRE3-BGHpA
Plasmid#230630PurposeAiE2136m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only