We narrowed to 4,666 results for: Gca
-
Plasmid#77617Purpose3rd generation lentiviral gRNA plasmid targeting human AURKBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pXPR_BRD051-sgCh2-2
Plasmid#125775Purposeconstitutive expression of a guide RNA targeting an intergenic region of human chromosome 2 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgCh2-2
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
LCV2_PSMD1_sgRNA_1
Plasmid#155091Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMVblast_SLC38A2_N82A
Plasmid#156181PurposeCMV-driven expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterCMVAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pInducer20_SLC38A2_N82A
Plasmid#156183PurposeDox-inducible expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterTREAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_PSMD1_sgRNA_1
Plasmid#155107Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1270 - pAAV Rosa26 gRNA A+B EF1a EGFP
Plasmid#113156PurposeAn AAV vector that expresses guide RNAs targeting rat Rosa26 and expresses EGFP reporterDepositorInsertTwo gRNAs for rat Rosa26
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shGDF11 #1
Plasmid#83083PurposeLentiviral shRNA vector for inducible knockdown of human GDF11 (cross reacts with mouse Gdf11)DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
TAF1 gRNA (BRDN0001147230)
Plasmid#77869Purpose3rd generation lentiviral gRNA plasmid targeting human TAF1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
TTN gRNA (BRDN0001148405)
Plasmid#76852Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001146399)
Plasmid#76853Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_1k)-PGKpuro2ABFP-W
Plasmid#208410PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB.DEST-ITGB1(YYFF)-mRuby2
Plasmid#215449PurposePiggybac expression vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
KHC064 pX335 BRD2 K1-1a
Plasmid#231711PurposeKHC064 (pX335 BRD2 K1-1a), gRNA and cas9D10A mammalian expression vector for CRISPR mediated cutting of BRD2 at the N-terminus, use with KHC065DepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk1_#1-puro
Plasmid#231984PurposeKnockout mouse Ripk1DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk1 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk1_#2-puro
Plasmid#231983PurposeKnockout mouse Ripk1DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk1 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only