We narrowed to 11,167 results for: EPO
-
Plasmid#248787Purposefuse partial UTR and coding sequence of Brd9 (zebrafish) with EGFP reporterDepositorInsertbrd9 (brd9 Zebrafish)
UseBrd9(zebrafish)-egfp reporterTagsEGFPPromoterpartial 5'UTR sequence of zebrafish brd9Available SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBI121::chitRatioGFP:LAAQ
Plasmid#240451PurposeExpression of indicator protein fusion (modified ratiometric pHluorin & low affinity Aequorin) for monitoring calcium concentrations and pH in cell walls of higher plants. See Resource Information.DepositorInsertFusion of chitinase signal, soluble modified ratiometric pHluorin and low affinity Aequorin (D119A)
ExpressionBacterial and PlantMutationRatiometric GFP (ratiometric pHluorin) (PMID 9671…PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
STIM1-RspA-NFAST
Plasmid#233606PurposeExpression of hSTIM1-RspA-NFASTDepositorAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc LifeactΔC4-msfGFPΔN7
Plasmid#231555PurposeMammalian expression of C-terminally truncated Lifeact fused to N-terminally truncated monomeric superfolder GFP for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-MARINA
Plasmid#223328PurposeDONOR vector for genomic integration of MARINA voltage sensitive indicator gene from Platisa et al., 2017 (10.1021/acschemneuro.6b00234).DepositorInsertsMARINA
KIR2.1 channel Golgi-to-plasma membrane trafficking signal
UseCRISPR and Synthetic BiologyTagsmCherry and super-ecliptic pHluorinExpressionMammalianPromoterCAGAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-MHL.BMI1
Plasmid#224711PurposeExpresses N-terminal hexahistidine-tagged human BMI1 (PCGF4) in insect cells.DepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-Actin-Vhh-sfGFP-P2A-1xHA-iRFP-caax (JDW 1216)
Plasmid#224496PurposeGateway compatible middle entry clone containing an Actin nanobody fused to sfGFP followed by P2A and iRFP-caax tag (GFP actin reporter and cell membrane iRFP reporter)DepositorInsertActin-Vhh-sfGFP-P2A-HA-iRFP-caax
UseGateway cloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCL025 AAVS1-9xTetO-RSV-IGKleader-Cas9site-hIgG1_FC-Myc-PDGFRb-T2A-Citrine-PolyA
Plasmid#188743PurposeDonor vector for integrating RSV promoter-driven dual surface marker/mCitrine fluorescent reporter at AAVS1 locusDepositorInsertSurface marker and mCitrine reporter
UseSynthetic BiologyExpressionMammalianPromoterRSVAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCL026 AAVS1-9xTetO-hPGK-IGKleader-Cas9site-hIgG1_FC-Myc-PDGFRb-T2A-Citrine-PolyA
Plasmid#188744PurposeDonor vector for integrating PGK promoter-driven dual surface marker/mCitrine fluorescent reporter at AAVS1 locusDepositorInsertSurface marker and mCitrine reporter
UseSynthetic BiologyExpressionMammalianPromoterPGKAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCL051 AAVS1-9xTetO-nTATAchr21-IGKleader-Cas9site-hIgG1_FC-Myc-PDGFRb-T2A-Citrine-PolyA
Plasmid#188745PurposeDonor vector for integrating nonTATAchr21 promoter-driven dual surface marker/mCitrine fluorescent reporter at AAVS1 locusDepositorInsertSurface marker and mCitrine reporter
UseSynthetic BiologyExpressionMammalianPromoternonTATAchr21Available SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCL053 AAVS1-9xTetO-nTATAchrX-IGKleader-Cas9site-hIgG1_FC-Myc-PDGFRb-T2A-Citrine-PolyA
Plasmid#188746PurposeDonor vector for integrating nonTATAchrX promoter-driven dual surface marker/mCitrine fluorescent reporter at AAVS1 locusDepositorInsertSurface marker and mCitrine reporter
UseSynthetic BiologyExpressionMammalianPromoternonTATAchrXAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
PCRbluntII-pHES7-STOPgRNA
Plasmid#204349PurposegRNA to target pig HES7 stop codonDepositorInsertPig HES7-STOP-gRNA (HES7 Sus domesticus (pig))
ExpressionMammalianAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-EC1.45-human_min1-opossum_min2
Plasmid#173966PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertHuman minimal enhancer region 1 (min1) and opossum minimal enhancer region 2 (min2) from SOX9 enhancer cluster EC1.45
UseLuciferaseMutationSee Depositor Comments BelowPromoterSV40 promoterAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E7-D192D
Plasmid#154024PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 7 c.576C>T, p.D192D (Synonymous Mutation)DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.576C>T, p.D192DAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E11-G312G
Plasmid#154026PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 11 c.936T>G, p.G312G (Synonymous Mutation)DepositorInsertBAP1 Exon 11 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.936T>G, p.G312GAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ200
Plasmid#162673PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating S136C and a sequence Tyr75:Phe104 to introduce a 6th disulfide bond as in AoFaeB-2.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationS136C and a sequence Y75-F104 to introduce a 6th…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ210
Plasmid#162683PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating S136C, G489C, S530C, and a sequence Tyr75:Phe104 to introduce a 6th and 7th disulfide bond as in AoFaeB-2.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationS136C, G489C, S530C, and a sequence Y75-F104 to i…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ220
Plasmid#162686PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating lid deletion (Gly251:Thr472) and C224W and C529S mutations from PETase active site.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1) with lid deletion and C224W and C529S mutations
TagsHisExpressionBacterialMutationdeltaG251-T472, C224W, C529S; codon optimized for…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ221
Plasmid#162687PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating lid deletion (Gly251:Thr472) and C224H and C529F mutations from PETase active site.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), with lid deletion and C224H and C529F mutations
TagsHisExpressionBacterialMutationdeltaG251-T472, C224H, C529F; codon optimized for…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only